The N-terminal histidine (His)-tagged recombinant nebulette protein-affinity constructs cloned in this study were generated as follows: the plasmid encompassing modules 1–5 (M1–5) was amplified by PCR using Phusion high-fidelity polymerase (Finnzymes) as a BamHI-EcoRI insert using 5′ and 3′ primers (5′-CGC GGA TCC CCT GTT ATT GAA GAC TTA AGC ATG-3′; 5′-CCG GAA TTC GTC TTC CAA TTA CAG CGG GCT-3′); the plasmid encompassing the amino terminal end of nebulette through module 6 (N-M6) was amplified as a BamHI-EcoRI insert using 5′and 3′ primers (5′-CCG GAA TTC ATT AAC AAA CTC AAT GTA ATT CGC-3′; 5′-CGC GGA TCC ATG AGG GTC CCT GTA TTT GAG-3′). All these nebulette inserts were amplified from a pGEX4T-nebulette plasmid generously provided by C. Gregorio (University of Arizona). The PCR fragment was ligated into the corresponding BamHI-EcoRI sites of the 6×His-tag vector pET28a. The pIRES-His-nebulette M1–5 plasmid was cloned by subcloning the nebulette M1–5 BspEI-NotI insert using 5′ and 3′ primers (5′-GAG AGA TCC GGA CCT GTT ATT GAA GAC TTA AGC ATG-3′; 5′-GAG AGA GCG GCC GCG TCT TCC AAT TAC AGC GGG CT-3′) into pIRES-PURO3 HIS vector. The fidelity of the reading frames was verified by sequencing.
Phusion high fidelity polymerase
Manufactured by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom, Lithuania, Finland
Phusion high-fidelity polymerase is a DNA polymerase enzyme used in PCR (Polymerase Chain Reaction) applications. It possesses high-fidelity, meaning it has a low error rate during DNA synthesis, making it suitable for applications that require accurate DNA replication.
Automatically generated - may contain errors
Lab products found in correlation
T4 dna ligase, by Thermo Fisher Scientific (5 mentions)
Qiaquick pcr purification kit, by Qiagen (4 mentions)
Dntps, by Thermo Fisher Scientific (4 mentions)
T4 ligase, by Thermo Fisher Scientific (3 mentions)
Gibson assembly, by New England Biolabs (3 mentions)
Qiamp dna mini kit, by Qiagen (3 mentions)
High pure pcr product purification kit, by Roche (3 mentions)
Qiaquick gel extraction kit, by Qiagen (3 mentions)
Genelute pcr clean up kit, by Merck Group (3 mentions)
Genelute plasmid miniprep kit, by Merck Group (3 mentions)
Zymoclean gel dna recovery kit, by Zymo Research (3 mentions)
Nebuilder hifi dna assembly master mix, by New England Biolabs (3 mentions)
Gateway cloning system, by Thermo Fisher Scientific (2 mentions)
Transcriptor first strand cdna synthesis kit, by Roche (2 mentions)
Restriction endonuclease, by Thermo Fisher Scientific (2 mentions)
Ariafacs 3, by BD (2 mentions)
Repli g advanced single cell storage buffer, by Qiagen (2 mentions)
Repli g advanced dna single cell kit, by Qiagen (2 mentions)
Minelute gel extraction kit, by Qiagen (2 mentions)
Qiaamp viral rna mini kit, by Qiagen (2 mentions)
112 protocols using phusion high fidelity polymerase
1
Recombinant Nebulette Protein Constructs
2
Phylogenetic Characterization of Bdellovibrio Strain
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To phylogenetically characterize the pure Bdellovibrio strain isolated in the coculture, Bdellovibrio genomic DNA was purified from 0.45-μm filtered, host-dependently grown (before and after separation from the associated phage) and unfiltered host-independently grown B. bacteriovorus angelus using a Genelute bacterial genomic DNA kit (Sigma) according to the manufacturer’s instructions. The full-length 16S rRNA gene was amplified from a total of 11 individual genomic DNA samples using Phusion high-fidelity polymerase (Finnzymes) according to the manufacturer’s guidelines using the general bacterial primers 8F (50 (link)) and 1492r (51 (link)). Purified PCR products were sent for sequencing at MWG Biotech, Ltd., and the full-length double-stranded sequence was aligned to that of the B. bacteriovorus type strain HD100 (37 (link)).
3
Mutagenesis using Phusion Polymerase
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primers for point mutations were designed with the help of the Agilent QuikChange Primer Design program. Mutagenesis was performed by PCR with the Phusion High Fidelity Polymerase (Finnzymes, Thermo-Fisher Scientific).
4
Skeletal Muscle RNA Extraction and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from skeletal muscle using TRI Reagent (MRC, Cincinnati, OH, USA). First-strand cDNA synthesis reaction from total RNA was catalyzed by Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostic, Penzberg, Germany). cDNA was amplified with specific primers using Phusion High-Fidelity polymerase (Finnzymes, Thermo Fisher Scientific, Waltham, MA, USA). The PCR products were purified and sequenced directly with BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems, Life Technologies, Carlsbad, CA, USA). Sequences were analyzed on an ABI Prism 3100 Genetic Analyzer (Applied Biosystems, Life Technologies, Carlsbad, CA, USA). Results were compared to the human cDNA DNM2 database sequence NM_001005360.1.
5
Cloning and Fusion of MtNHX7 Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The MtNHX7 open reading frame and its 2.5-kb regulatory sequence were amplified via PCR from nodule cDNA and genomic DNA, respectively, using Phusion high-fidelity polymerase (Finnzymes). The coding sequence of MtNHX7 was directionally cloned into a modified pENTR vector (pENTR2) containing a multiple cloning site. Entry clones for MtNHX7 promoters were generated by TOPO cloning (Invitrogen, Waltham, MA, USA). The Gateway cloning system (Invitrogen) was used to create a genetic construct with the GFP fusion [59 (link)]. The pENTR clone of MtNHX7 was recombined into the pKGW-GGRR destination vector using LR Clonase (Invitrogen): The ProMtNHX7:MtNHX7:GFP translational fusion driven by the 2.5 kb native 5′ regulatory sequences with its own promoter was generated by multiple cloning of gene and promoter sequences into the pKGW-MGW vector. Primers are listed in Table S1 . Gene identifiers of MtNHX6 (Medtr2g028230) and MtNHX7 (Medtr2g038400), respectively. Primers are listed in the Table S6 .
6
Cloning and Characterization of MtAKT1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The MtAKT1 ORF and its 2.5 kb regulatory sequence were amplified via PCR from nodule cDNA and genomic DNA, respectively, using Phusion high-fidelity polymerase (Finnzymes).
MtAKT1 and MtAKT1 putative promoters were directionally cloned into a pENTR-D-TOPO plasmid (Invitrogen). The Gateway cloning system (Invitrogen) was used to create genetic constructs for promoter:GUS (β-glucuronidase) and GFP (green fluorescent protein) fusions. pENTR-D-TOPO carring MtAKT1 was recombined using Gateway LR Clonase II (Invitrogen) into the Gateway destination vector pKGW-GGRR by LR reaction to create the ProMtAKT1:GUS fusion. To make the ProMtAKT1:MtAKT1:GFP translational fusion, MtAKT1 was cut out from pENTR-D-TOPO with restriction enzymes NotI and AscI, purified from a gel, and ligated into pENTR 4, 1 digested with BsaI. Afterwards, pENTR constructions containing ProMtAKT1 and MtAKT1 and pENTR 2, 3 containing GFP were introduced by multisite LR recombination into the Gateway destination vector pKGW-MGW. All primers used are listed inSupplementary Table S1 .
MtAKT1 and MtAKT1 putative promoters were directionally cloned into a pENTR-D-TOPO plasmid (Invitrogen). The Gateway cloning system (Invitrogen) was used to create genetic constructs for promoter:GUS (β-glucuronidase) and GFP (green fluorescent protein) fusions. pENTR-D-TOPO carring MtAKT1 was recombined using Gateway LR Clonase II (Invitrogen) into the Gateway destination vector pKGW-GGRR by LR reaction to create the ProMtAKT1:GUS fusion. To make the ProMtAKT1:MtAKT1:GFP translational fusion, MtAKT1 was cut out from pENTR-D-TOPO with restriction enzymes NotI and AscI, purified from a gel, and ligated into pENTR 4, 1 digested with BsaI. Afterwards, pENTR constructions containing ProMtAKT1 and MtAKT1 and pENTR 2, 3 containing GFP were introduced by multisite LR recombination into the Gateway destination vector pKGW-MGW. All primers used are listed in
7
DNA Amplification and Modification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR reactions for amplification of DNA were performed using the Phusion High-Fidelity Polymerase (Fermentas, St. Leon-Rot, Germany) and the Omnigene HBTR3CM DNA cycler (Hybaid, Heidelberg, Germany). Digestion of DNA was accomplished by use of restriction endonucleases (Fermentas, St. Leon-Rot, Germany). Ligation of restricted DNA fragments was performed using T4-Ligase (Invitrogen, Karlsruhe, Germany). Oligonucleotides were synthesized by MWG-Biotech (Ebersberg, Germany) and are listed in S1 Table .
8
DNA Amplification and Manipulation Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA fragments were amplified via PCR in a thermocycler (peqSTAR 2x Gradient Thermocycler, Peqlab Biotechnologie GmbH, Erlangen, Germany) using taq (Biomix, Bioline, London, UK) or Phusion High Fidelity polymerase (Fermentas, St. Leon-Roth, Germany). Used oligonucleotides were produced by MWG-Biotech (Ebersberg, Germany) and are listed in S1 Table . Restriction endonucleases (Fermentas, St. Leon-Rot, Germany) were used for DNA digestion; T4-Ligase (Invitrogen, Karlsruhe, Germany) was used for ligation.
9
Complementation of nunF Deletion in P. fluorescens
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmid pHN1270 harboring the apramycin selectable marker was used as a complementation vector. The nunF gene was amplified from strain In5 genomic DNA by PCR using Phusion High Fidelity Polymerase (Fisher Scientific) and forward (5′‐GGAATTAACCATGCAGTGGTGGTGGTGGTGGTGCTCGAGAGGAGGACCGACCATGAATCG‐3′) and reverse (5′‐AATCTGTATCAGGCTGAAAATCTTCTCTCATCCGCCAAAACTAGTTTACGCCCCGATCATCCATTTG‐3′) primers to yield a 931‐bp fragment which was fused by Gibson Assembly® (NEB) into pHN1270 linearized by NcoI and SpeI and transformed into E. coli DH5α™ (NEB). Fusion of the amplicon and plasmid was confirmed by restriction digest of plasmid DNA followed by Sanger sequencing (GATC‐Biotech, Konstanz, Germany) to confirm integrity of the DNA sequence. The resultant construct was then transformed into strain In5 by electroporation described earlier. Complementation was tested using the antifungal activity assay described below with the following strains: P. fluorescens In5 WT, ΔnunF with the control empty vector pHN1270 with or without IPTG (2 mmol/L) induction, and ΔnunF with the complementation plasmid pHN1270::nunF with or without IPTG (2 mmol/L) induction. Complementation was performed with biological triplicates and repeated twice.
10
Genetic Engineering of P. thermoglucosidasius
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The wild type ptsG, rbsR, and apt along with their native promoters were individually amplified from P. thermoglucosidasius DSM 2542 genomic DNA using primers listed in Table 3 with Phusion high-fidelity polymerase (Fisher Scientific, Loughborough, UK) following the manufacturer's protocol. Each of the gene fragments, purified by gel electrophoresis, were cloned into a pair of BsaI sites on the plasmid pG2K-oriT-bgl-sfgfp-GG (Ortenzi, unpublished) via Golden Gate Assembly (Engler et al., 2009 (link); Reeve et al., 2016 (link)). Chemically competent E. coli DH5α cells were prepared and transformed with the reaction mixes, respectively, by heat shock as described previously (Chang et al., 2017 ). The presence of the requisite pJL-ptsG+, pJL-apt+, and pJL-rbsR+ constructs was confirmed by colony PCR of transformants grown on LB agar plates containing 50 μg/mL kanamycin with primers 7Fw and 7Rv, then the amplified product was authenticated by sequencing (GATC services, Eurofins Genomics, Cologne, Germany). Then, 2DG-ADE2b was transformed with pJL-ptsG+, pJL-apt+, and pJL-rbsR+, respectively, via conjugation as described previously (Liang et al., 2021 (link)). The continued presence of the gene inserts in the 2DG-ADE2b transformants was confirmed by colony PCR.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!