Sybr green

Total RNA was isolated using RNAiso Plus reagent (TaKaRa Bio, Shiga, Japan). An equal amount of total RNA was used to synthesize complementary DNA using the Prime-Script RT Reagent Kit (TaKaRa Bio), according to the manufacturer’s protocol. To assess the anti-adipogenic effect of FE and BFE, the mRNA expression levels of 3T3-L1 adipocytes and rat tissue-derived samples were analyzed using end-point PCR and qPCR, respectively. qPCR was performed using SYBR Green (Toyobo, Osaka, Japan) in conjunction with an iCycler iQ™ Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, CA, USA). The expression levels of RNA isolated from mouse 3T3-L1 adipocytes and rat tissues were normalized to β-actin and GAPDH, respectively. All primers were synthesized by Macrogen (Seoul, Korea) and primer sequences are listed in Table 1.

THP-1 cell-derived macrophages were treated using the method as described above. The total RNA extractions and cDNA synthesis were performed using kits (TOYOBO, Japan). Bio-Rad C100 was employed for RT-qPCR analysis using SYBR green (TOYOBO, Japan). The levels of target genes were normalized to GAPDH, a housekeeping gene, for calculation using the 2^−ΔΔCT method. The primer sequences of genes are listed in Table S1.

Tissues from postnatal day 15 (PND 15) wild-type mice were separated and grinded with liquid nitrogen. Total RNAs were extracted with RNAsimple Total RNA Kit (Tiangen, China) and complementary DNAs (cDNAs) were synthesized using ReverTra^® Ace Qpcr RT Master Mix (Toyobo, Japan). Mouse Gapdh, Mkrn3, Pabpc1, Pabpc3 (also known as Pabpc6) and Pabpc4 were amplified using 2xPCR mixure (Tiangen), and detected by DNA gel electrophoresis. For mRNA half-life experiments, cells were incubated with medium supplemented with 5μg/mL Actinomycin D for 0, 2, 4 or 6 h prior to harvest. Total RNAs were extracted from the indicated cells and cDNAs were synthesized. Quantitative PCR (qPCR) Gene amplifications were performed using SYBR Green (Toyobo) on a 7500 real-time PCR machine (ABI7500, Thermo Fisher, USA), QuantStudio™ 6 Flex (Thermo Fisher) or Roche LightCycler^® 96 (Roche, Switzerland), with the relative abundance of each transcript normalized to that of GAPDH/Renilla gene, using the 2^ΔΔCt method (38 (link)). Sequences for the primers used in this study were listed in Supplementary Table S3. Shown in Supplementary Table S4 were the detailed data for three independent biological replicates in the RNA decay experiments, and the original raw data for these qPCR were also provided as supplementary file 1.

Protein extraction and western blotting were performed as previously described (Qiao et al., 2015 (link)). Antibodies for OPG, glucose transport protein 3 (GLUT3) (Abcam, United Kingdom), phosphorylated (p)AKT/AKT (CST, United States), PCNA, GAPDH and β-actin (Sigma, United States) were used. Real-time qPCR was performed as previously described (Huang et al., 2018 (link)). Total RNA was isolated from mouse tissues or cells using RNA plus liquid kits (Takara, Japan) following the manufacturer’s protocol. RNA (0.5–2 μg) was reverse transcribed into cDNA using reverse transcription kits (Toyobo, Japan). Expression levels of several genes were determined by real-time RT-PCR using a Roche LightCycler^TM instrument (Roche) with SYBR Green (Toyobo) detection according to the manufacturer’s protocol. The following RT-PCR primers were used: mouse primer sequence of 18S rRNA (forward, GATCCCGGCTCTTAATATTCGAAT; reverse, GCCAGAGTCTCGTTCGTTATC); and OPG (forward, CCGAGTGTGTGAGTGTGAGG; reverse CCAGCTTGCACCACTCCAA).

Isolated liver tissues or cells were homogenated. Total RNA was isolated using Sepasol (Nacalai Tesque, Kyoto, Japan), and isolated RNA was used to synthesize complementary cDNA using SuperScript Reverse Transcriptase (Roche, Madison, WI, USA), as previously described [22 (link)]. Quantitative real-time PCR analysis based on the intercalation of SYBR Green (Toyobo, Osaka, Japan) were performed, as described previously [23 (link)]. Primer sequences used are summarized in Supplementary Table S1. A non-regulated housekeeping gene HPRT or GAPDH served as an internal control and was used to normalize for differences in input RNA.

SYBR green (TOYOBO) real-time PCR (Q-PCR) for UCP2 was performed using cDNA generate fdrom total RNA extracted from LV tissue. UCP2 primers are as follows: sense, 5′-ATGGTTGGTTTCAAGGCCACA-3′ and antisense, 5′- TTGGCGGTATCCAGAGGGAA-3′.