Total RNA was extracted from heart tissues or cells using a RNEase kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol. A total of 500 ng of RNA was used for subsequent cDNA preparation and quantitative PCR using SYBR-Green (Thermo Fisher Scientific). The results were normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The primer sequences used for amplification of DRP1, Fis1, Mff, Mfn1, Mfn2, ZFP36L2, PVT1, miR-21-5p, MARCH5, and GAPDH are listed in Supplementary Table S1 .
Rnease kit
Manufactured by Qiagen
Sourced in Germany
The RNease kit is a laboratory tool designed for the isolation and purification of RNA from various biological samples. It provides a reliable and efficient method for extracting high-quality RNA for further analysis and applications.
Automatically generated - may contain errors
Lab products found in correlation
Humanht 12 v4, by Illumina (2 mentions)
Nanodrop 1000a spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Bioanalyzer rna nano chip, by Agilent Technologies (2 mentions)
Abi 7900ht fast real time pcr system, by Thermo Fisher Scientific (2 mentions)
High capacity cdna reverse transcriptation kit, by Thermo Fisher Scientific (2 mentions)
Sybr green, by Thermo Fisher Scientific (1 mentions)
Quantifast sybr green, by Qiagen (1 mentions)
Steponeplus cycler, by Thermo Fisher Scientific (1 mentions)
Rneasy, by Qiagen (1 mentions)
Turbo dna free kit, by Thermo Fisher Scientific (1 mentions)
Superscript 3 first strand synthesis system for rt pcr, by Thermo Fisher Scientific (1 mentions)
Nanodrop 1000, by Thermo Fisher Scientific (1 mentions)
Lightcycler lc480, by Roche (1 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions)
Totalprep rna amplification kit, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Totalprep 96 rna amplification kit, by Thermo Fisher Scientific (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
9 protocols using rnease kit
1
Cardiac RNA Extraction and qPCR Analysis
2
Quantification of E7 Viral Titres
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RD cells were seeded at 1 × 10∧5 cells per well in 24-well plates and subsequently infected with the wild-type (WT) E7 or E7 R2 mutants at a multiplicity of infection (MOI) of 0.01 or 1000 E7 RNA copies per cell. One hour post infection the inoculum was removed and cells were washed with phosphate buffered saline (PBS) before adding 500 μl cell culture medium. At the indicated times post infection the cell culture medium was aspirated and stored at −80°C. Where applicable, cells were lysed in 300 μl RLT lysis buffer and stored at −80°C before RNA isolation with the RNease kit (Qiagen). Viral titres were determined in an end point dilution assay (EPDA) by determining the tissue culture infectious dose 50% (TCID50) in RD cells.
Total RNA was harvested according to the manufacturer’s protocol (RNeasy, Qiagen). In a one-step reaction Quantifast Sybr green (Qiagen) total RNA was reverse transcribed with gene specific primers amplifying either E7 (primer pair E7 5’-UTR) or the internal control GAPDH (Supplementary file 1A ) using the Stepone plus cycler (Applied Biosystems).
Total RNA was harvested according to the manufacturer’s protocol (RNeasy, Qiagen). In a one-step reaction Quantifast Sybr green (Qiagen) total RNA was reverse transcribed with gene specific primers amplifying either E7 (primer pair E7 5’-UTR) or the internal control GAPDH (
3
RNA Extraction and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from frozen tissues using TRI reagent (Molecular Research Inc. Cincinnati, OH), according to the manufacturer's instruction. RNA samples were treated with the TURBO DNA-free kit (Applied Biosystems, Foster City, CA), further purified through an RNease kit (Qiagen), and quantified with a NanoDrop-1000 (NanoDrop Technologies Inc., Wilmington, DE). All purified RNA samples were diluted and adjusted to 400 ng/µl to ensure equal amounts of cDNA template for quantification of mRNA abundance. cDNA was synthesized using SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen, Grand Island, NY), according to the manufacturer's guidelines.
4
Quantifying Gene Expression via qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNA was purified from brain tissues or cultured cells using RNease kit (Qiagen) following the manufacturer's protocol. For quantitative real‐time PCR (qPCR), RNA was reverse‐transcribed using the High‐Capacity cDNA Reverse Transcription Kit (Applied Biosystems) according to the manufacturer's instructions. The resulting cDNA was analyzed by qRT‐PCR using SYBR Green PCR Master Mix (Applied Biosystems). All reactions were performed in a Roche LightCycler (LC) 480 instrument using the following protocol: pre‐incubation at 95 °C for 15 min (1 cycle), denaturation at 94 °C for 15 s, annealing and extension at 55 °C for 30 s (40 cycles), and melting at 95 °C for 5 s, 65 °C for 60 s and 95 °C continued (1 cycle) followed by cooling at 40 °C for 30 s. The specificity of the primers was confirmed by observing a single melting point peak. qPCR efficiency was calculated from the slope between 95 and 105% with co‐efficiency of reaction R2 = 0.98–0.99. A total of 7–9 biological replicates × at least 3 technical replicates were performed for each treatment group. Data was analyzed using the comparative Ct method (ΔΔCt method).
5
Mitochondrial Dynamics Analysis in Heart Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from heart samples or cells using a RNEase kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol. A total of 500 ng of RNA was used for subsequent cDNA preparation and quantitative PCR using SYBR-Green (Thermo Fisher Scienti c), and the results were normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The primer sequences used for ampli cation of DRP1, Fis1, Mff, Mfn1, Mfn2, ZFP36L2, PVT1, miR-21-5p, MARCH5, and GAPDH are listed in Table S1.
6
Biotin-labeled RNA Analysis of bLf Effects
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HT-29 cells (1.6 x 10 4 /cm 2 , 6-well plate) were grown over night and then treated with bLf (800 µg/mL), LfcinB-C (400 µg/mL), or LfcinB-L (400 µg/mL) for 12 h. RNA was extracted from the harvested cells using Trizol Reagent (Invitrogen). RNA was then purified by an RNease kit (Qiagen) according to the manufacturer's instructions. Measurement of RNA yield was performed using a NanoDrop 1000A Spectrophotometer (Thermo Fisher Scientific, Waltham, MA), and RNA quality was verified by using Bioanalyzer RNA Nano Chips (Agilent Technologies, Inc., Santa Clara, CA) following the manufacturer's procedure.
Total RNA samples were amplified and labeled with biotinylated nucleotides using a kit (Ambion, TotalPrep RNA Amplification Kit). Bioanalyzer analysis was then performed to verify if cRNA was at the expected 1.2 kb average size before applying to bead chips (HumanHT-12 v.4.0, Illumina, San Diego, CA). Bead chips were scanned with the Illumina iScan using standard conditions.
Total RNA samples were amplified and labeled with biotinylated nucleotides using a kit (Ambion, TotalPrep RNA Amplification Kit). Bioanalyzer analysis was then performed to verify if cRNA was at the expected 1.2 kb average size before applying to bead chips (HumanHT-12 v.4.0, Illumina, San Diego, CA). Bead chips were scanned with the Illumina iScan using standard conditions.
7
Optimization of Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HDFn (6-well plate, 2.5 x 10 3 /cm 2 ) were grown for 24 h and then treated with CbLf (100 µg/mL), SLs (10 µg/mL), or CbLf-SLs-assembly for 24 h. RNA was subsequently extracted with Trizol (Invitrogen), and then purified by the RNease kit (Qiagen) according to the manufacturer's instructions. Measurement of RNA yield was performed using a NanoDrop 1000A Spectrophotometer (Thermo Fisher Scientific, Waltham, MA), and RNA quality was evaluated by Bioanalyzer RNA Nano Chips (Agilent Technologies, Inc., Santa Clara, CA) following the manufacturer's procedure.
Total RNA samples were amplified and labeled with biotinylated nucleotides using a kit (Ambion, TotalPrep -96 RNA Amplification Kit). Bioanalyzer analysis was then carried out to verify if cRNA was at the expected the 1.2 kb average size before applying to D r a f t 8 beadchips (HumanHT-12 v.4.0, Illumina, San Diego). Beadchips were scanned with the Illumina iScan using standard conditions.
Total RNA samples were amplified and labeled with biotinylated nucleotides using a kit (Ambion, TotalPrep -96 RNA Amplification Kit). Bioanalyzer analysis was then carried out to verify if cRNA was at the expected the 1.2 kb average size before applying to D r a f t 8 beadchips (HumanHT-12 v.4.0, Illumina, San Diego). Beadchips were scanned with the Illumina iScan using standard conditions.
8
Quantitative RT-PCR for ZMYND8 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using RNease kits (#74104, Qiagen), and cDNA was synthetized with a high-capacity cDNA reverse transcriptation kit (#4368813, Applied Biosystems). Quantitative Real-time RT-PCR was conducted using the ABI 7900 HT Fast Real Time PCR system (Applied Biosystems, Foster City, CA) as previously described (Yeo et al. 2018 ). The primer sequences of ZMYND8 were as follows : The forward primer was GGGTTTATCACGCTAAGTGTCTG, and the reverse primer was GGCTTTACTCTGGGTCTCGATG.
9
Quantitative RT-PCR for ZMYND8 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using RNease kits (#74104, Qiagen), and cDNA was synthetized with a high-capacity cDNA reverse transcriptation kit (#4368813, Applied Biosystems). Quantitative Real-time RT-PCR was conducted using the ABI 7900 HT Fast Real Time PCR system (Applied Biosystems, Foster City, CA) as previously described (Yeo et al. 2018 ). The primer sequences of ZMYND8 were as follows : The forward primer was GGGTTTATCACGCTAAGTGTCTG, and the reverse primer was GGCTTTACTCTGGGTCTCGATG.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!