Pmirglo

The fragment of the mouse SOCS3 3′-UTR (1484 nt) containing two potential miR-3473b target sites (nucleotides 76–82 and 1301–1307 of the SOCS3 3′-UTR, CCGACCU) and a fragment containing a mutated miR-3473b target site (CCCAGCA) within the seed region were inserted into the luciferase reporter plasmid (pmirGLO, GenePharma). HEK-293 cells were seeded into 24-well plates and co-transfected with 200 ng of the luciferase reporter plasmid and 50 nM of the miR-3473b mimic (GGGCUGGAGAGAUGGCUCAG) using Lipofectamine 2000 (Invitrogen). After 48 h, the firefly and Renilla luciferase activity were measured with the dual-luciferase reporter assay system (Promega) according to the manufacturer’s instructions. Firefly luciferase activity was normalized to Renilla luciferase activity for each transfected well. The experiments were performed in triplicate.

Starbase online tool uncovered that there may be binding sites between DLX6-AS1 and miR-204-5p or betweenmiR-204-5p and FBXW7. To verify this speculation, the luciferase reporter vectors pmir-GLO containing wild type (WT) or mutant type (Mut) of DLX6-AS1 and FBXW7 were constructed by GenePharma. H9c2 cells were transfected with WT/Mut of luciferase reporter vectors and miR-204-5p mimic or NC-mimic using Lipofectamine 2000 Transfection Reagent. Finally, Luciferase Assay System (Ambion, Austin, TX, USA) was used to assess the relative luciferase activity of H9c2 cells.

The predicted SOX2OT 3′UTR or SOX5 3′UTR fragment containing miR-194-5p binding site was inserted into pmirGLO (GenePharma Co.Ltd., Suzhou, China) to obtain wild-type Report gene vectors. The target sequence was mutated to obtain the mutant vector SOX2OT 3′UTR mut and SOX5 3′UTR mut. After co-transfection, the luciferase activity of HT-29 and SW480 cells was detected by a dual-luciferase activity assay kit 48 h later. The mean luciferase intensity was normalized to renilla luciferase.