Nano glo hibit blotting system

The HiBiT Control Protein (Promega, Madison, WI, USA) is a 20 μM solution of purified recombinant 36 kDa HaloTag^® protein fused at its carboxy terminus to the 11-amino-acid HiBiT tag. The 20 μM HiBiT Control Protein was diluted 2000 times with the supernatant from the starch fermentation medium to obtain a solution of 10⁻⁸ M. Nine gradients were then diluted between 10⁻⁸ M and 10⁻⁹ M. The luminescence of each gradient was then detected to plot the calibration curve. A Tris-tricine-SDS-PAGE gel preparation kit (Solarbio, Beijing, China) was used for protein separation of the shake flask supernatant. After monellin was separated using Tris-tricine-SDS-PAGE, it was transferred to a PVDF membrane at 350 mA for 30 min. Protein blotting was performed using the Nano-Glo^® HiBiT Blotting System (Promega, Madison, WI, USA) according to the manufacturer’s instructions, and then the PVDF membrane was transferred to a gel multifunction imager and imaged after 5 min of exposure.

The HOXB9n and HOXB9v sequences were amplified by PCR and subsequently cloned into the pBiT3.1-N [CMV/HiBiT/Blast] expression vector (Promega, Tokyo, Japan) at the Xhol and BamHI sites using Ligation high Ver.2 (Toyobo). The primers used for amplification were as follows: sense, 3′ ATACCTCGAGGTCCATTTCTGG 5′; antisense, 3′ CACGTCATACGGATCCTCTTTG 5′. MCF7 cells were transfected with the HiBiT-tagged HOXB9n or HOXB9v vector using the Viafect Transfection reagent (Promega) and selected with 10 µg/mL of blasticidin for at least 4 weeks. The expression of HiBiT-tagged HOXB9n and HOXB9v proteins was detected using the Nano-Glo HiBiT Blotting System (Promega) as per the manufacturer's instructions.

For immunoblotting, goat anti-mouse or anti-rabbit IgG HRP-conjugated (1:5000, GE healthcare, #NA934V and #NA934V) was used along with chemiluminescent detection reagents (Thermo Scientific). The primary antibody included GAPDH (1:1000, Cell Signaling Technology, #2118), FLAG (1:1000, Sigma, #F1804), ZNF598 (1:1000, GeneTex, #GTX119246), PELO (1:1000, proteintech, #10582-1-AP).For HiBiT tag detecting, Nano-Glo® HiBiT Blotting System (Promega, N2410) was used according to the manufacturer’s instructions. Uncropped blots for Fig. 5b and Supplementary Fig. 7d, e can be found in the Source Data file.

Samples from cells transfected with HiBiT-tagged proteins were prepared following the same protocol as immunoblotting. Proteins were transferred to a nitrocellulose membrane, followed by gentle rocking in TBST to rinse away transfer buffer. Nano-Glo HiBiT blotting system (Promega) was used for development, following manufacturer’s protocol. Briefly, the blot was incubated in 5 ml 1× Nano-Glo blotting buffer supplemented with 25 μl LgBiT protein overnight at 4 °C. The next day, 10 μl Nano-Glo luciferase assay substrate was directly added into the solution and mixed well immediately. After incubation for 5 min at room temperature in dark, the blot was imaged by ChemiDoc Imaging System (Bio-Rad), using chemiluminescence mode.

Extracts were run on 8–12% SDS-PAGE gels, transferred to Immobilon-P Transfer Membranes (Millipore Corp.), and visualized with antibodies specific for β-catenin (E-5) (Santa Cruz, sc-7963), β-catenin (D10A8, Cell Signaling #8480S), β-catenin (15B8, Cell Signaling, #37447), Non-Phospho (active) β-catenin (Cell Signaling, #19807S), DVL2 (Cell Signaling #3216), anti-HiBiT (Clone 30E5, Promega, CS2006A01), FLAG M2 (Sigma, F3165), anti-FLAG (Cell Signaling, D6W5B), V5 Tag (Thermo Fisher, R960-25), V5-tag (D3H8Q, Cell Signaling, #14793), GAPDH Ab (6C5) (Abcam, ab8245), NanoGlo HiBiT Blotting System (Promega, PRN2410), and UL44 (Virusys Corporation, P1202-2).

Samples from cells with HiBiT-tagged proteins were prepared following the same protocol as immunoblotting. Proteins were transferred to a nitrocellulose membrane, followed by gentle rocking in TBST to rinse away transfer buffer. Nano-Glo HiBiT blotting system (Promega) was used for development, following manufacturer’s protocol. Briefly, the blot was incubated in 5 ml 1 × Nano-Glo blotting buffer supplemented with 25 μL LgBiT protein overnight at 4 °C. The next day, 10 μL Nano-Glo luciferase assay substrate was directly added into the solution and mixed well immediately. After incubation for 5 min at room temperature in dark, the blot was imaged by ChemiDoc Imaging System (Bio-Rad), using chemiluminescence mode.