Rq1 rnase free dnase product

Total RNA was prepared from fruit tissue using ISOLATE II RNA Plant Kit (Bioline, Taunton, MA, USA). Genomic DNA contamination was removed by DNase treatment (RQ1 RNase‐Free DNase Product, Promega, Madison, WI, USA). Quantitative PCR was performed with a StepOnePlus real‐time PCR system using SensiFAST^™ SYBR Hi‐ROX One‐Step Kit (Bioline). The oligonucleotides used for quantitative real‐time PCR were as follows: AroG: forward 5′‐ATCACCCCACAA TATCTCGC‐3′ and reverse 5′‐AGCCACTTTAATCGTACCGTC‐3′; PhODO1: forward 5′‐GAAAACTCTTCATGCACCAC‐3′ and reverse 5′‐ TCAAAACCAAAGTCATTGATACC‐3′.

To quantify HSV-1 gene expression, total RNA was purified with RNeasy Kit (Qiagen) according to the manufacturer's instructions followed by a DNase digestion step (RQ-1 RNase free DNase product, Promega). Total RNA from HSV-1 infected shControl or shCIB1 transduced HMVEC-d cells was reverse transcribed with a high-capacity cDNA reverse transcription kit according to the suppliers (Applied Biosystems). Equal volumes of prepared cDNA were used for quantification of HSV-1 gene ICP0 and ICP4 transcripts with the Power SYBR Green PCR master mix (Applied biosystems) according to the manufacturer's protocol. The primers used were:
ICP0 - 5′- AAGCTTGGATCCGAGCCCCGCCC-3′ (forward), and
5′-AAGCGGTGCATGCACGGGAAGGT-3′ (reverse);
ICP4 - 5′ - GACGTGCGCGTGGTGGTGCTGTACTCG-3′ (forward), and
5′ - GCGCACGGTGTTGACCACGATGAGCC-3′ (reverse) [61] (link).
Samples were normalized relative to tubulin Ct. and primer pairs used for tubulin transcript detection were 5′-TCCAGATTGGCAATGCCTG-3′ (forward), and 5′-GGCCATCGGGCTGGAT-3′ (reverse). Relative changes in gene expression were analyzed using the 2^−ΔΔCt method.

Total RNA was extracted from sperm pools of: control groups AB (n = 4) and Tg(ins:nfsb-mCherry) (n = 7) and Met-treated groups AB (n = 4) and Tg(ins:nfsb-mCherry) (n = 7). Each pool contained sperm from 5 males. The sperm sample of each male was collected, diluted in 10 µL of phosphate-buffered buffer (PBS), and added to NZYol reagent (NZYTech, Lisbon, Portugal), according to the manufacturer’s specifications. DNAse treatment was performed using RQ1 RNase-Free DNase product (Promega, Madison, WI, USA) to remove genomic DNA contamination. The purity of the RNA samples was evaluated. The concentration and purity of the total RNA samples were evaluated using a NanoDrop 1000 (Thermo Fisher Scientific, Waltham, MA, USA) and the 260/280 ratios were 1.8–2.0. The integrity of the obtained RNA was assessed through Experion RNA analysis (Biorad, Hercules, CA, USA). Complementary DNA (cDNA) was synthesized from 500 ng of the total RNA using the M-MLV reverse transcriptase kit (Thermo Fisher Scientific, Waltham, MA, USA) with an oligo (dT) primer following the manufacturer’s protocol. The reverse transcription conditions were 37 °C for 1 h followed by 70 °C for 15 min, and the samples were stored at −20 °C until further analysis.