Pcdh cmv mcs ef1 copgfp vector

The pCDH-451 plasmid was produced by li-gating 250 bp fragments encompassing pri-Mir-451 sequences into the XbaI /BamHI restriction
sites of the pCDH-CMV-MCS-EF1-copGFP vector (System Biosciences, USA). These fragments
were elevated by polymerase chain reaction (PCR)
reaction using following primers: pri-Mir-451 F:
5′-GTC GTA TGC AGA GCA GGG TCC GAGGTA TTC GCA CTG CAT ACG ACA ACT CA3′ and R: 5′GTCGTATGCAGAGCAGGGTCCGAGGTATTCGCACTGCATACGACAACCTC-3′ on extracted genomic DNA. For lentivirus
production; HEK-293T cells (3×10³) were seeded
into 10-cm plates containing DMEM medium supplemented with 10% FBS. The day after, pPAX2
plasmid (containing gag and pol genes) and pMD2
plasmid (containing vsv gene) were co-transfected with the pCDH-451 plasmid empty vector (pCDH
empty backbone) as negative control into seeded
HEK-293T cells using the lipofectamin 2000 reagent
(Invitrogen, USA) according to the manufacturer’s
protocol. The supernatants containing generated lentiviruses were collected every 12 hours for 3 days after
transfection and concentrated by ultracentrifugation
at 40.000 g for 2 hours. Then for virus titration, HEK-293T cells were transduced with a different concen-
tration of recombinant lentiviruses and the number
of viruses in the functional copy was detected using
green fluorescent protein (GFP) protein and fluorescent microscope forty-eight hours later.

The plasmids expressing hsa-miR-205 and hsa-miR-31 precursors in lentiviral pCDH-CMV-MCS-EF1-copGFP vector (System Bioscience) were provided by Dr. Yin-Yuan Mo (University of Mississippi Medical Center). The lentiviral constructs with puromycin for shRNA plasmid-A and shRNA plasmid UBE2N were purchased from Santa Cruz Biotechnology, Inc. (Texas, USA).

To generate lentiviruses for the overexpression of HNF1α and HNF1A-AS1, full-length cDNA of HNF1α and HNF1A-AS1 were cloned into the pCDH-CMV-MCS-EF1-copGFP vector (System Biosciences). For HNF1α-targeting short hairpin RNA expression, oligonucleotides encoding HNF1α short hairpin RNA (GATCCGGTCTTCACCTCAGACACTTTC AAGAGAAGTGTCTGAGGTGAAGACCTTTTTG) were cloned into the pmiRZIP vector (System Biosciences). All vectors were verified by sequencing. The primer sequences are listed in Additional file 1: Table S1.
The lentiviral vectors were transfected into subconfluent HEK293T cells together with the packaging plasmid psPAX2 and envelope plasmid pMD2.G (Addgene) using FuGENE 6 transfection reagent (Promega) to produce lentiviral particles. The lentiviruses in the medium were collected 48 h later and concentrated by ultracentrifugation.

A normal pancreatic cell line (HPDE) and four cancer cell lines (CAPAN-2, AsPC-1, SW1990 and PANC-1) were used in this study. All the cell lines were purchased from Cell Resource Center of Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences (Shanghai, China), and were cultured in DMEM containing 10% fetal bovine serum (Gibco, Grand Island, NY, USA) in a humidified atmosphere of 5% CO₂ at 37 °C. For the inhibition and overexpression of miR-92b-3p and Gabra3, AsPC-1 and SW1990 cells were cultured to 60–70% confluence and then transfected with a miR-92b-3p mimic, miR-92b-3p inhibitor, GABRA3 overexpression vector, GABRA3 shRNAs (GCTGAAGTGGTTTATTCTTGG and GCTCTTTGCCATATTCAATCT) or respective controls (GenePharma, Shanghai, China) using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. After 24 or 48 h, the cells were collected for subsequent experiments. The human miR-92b-3p construct was created by inserting the coding sequence (CDS) of miR-92b-3p into the pCDH-CMV-MCS-EF1-copGFP vector (System Biosciences, Palo Alto, CA, USA). AsPC-1 cells stably overexpressing miR-92b-3p were created according to a previously described procedure [37 (link)].

The Sp110 ORF sequence was amplified by PCR using cDNA from C57BL/6 mouse lung. The lentiviral expression vector pCDH-Sp110 was generated by inserting Sp110 ORF sequence into the pCDH-MCS-T2A-Puro-MSCV vector (System Biosciences, Mountain View, CA). To generate lentiviral vector expressing Bmf, the ORF sequences encode isoforms of Bmf were amplified by PCR using different upstream primers and a common downstream primer, and a FLAG tag was fused at the N-terminus, the resulting fragments were cloned into pCDH-MCS-T2A-Puro-MSCV, respectively. To construct the pCDH-miR-125a vector, DNA sequence of the primary miR-125a was amplified and inserted into the pCDH-CMV-MCS-EF1-copGFP vector (System Biosciences). To construct the luciferase reporter plasmids, the 3′ UTR sequence of mouse Bmf mRNA was amplified by RT-PCR and cloned into psiCHECK-2 (Promega, Madison, WI). The mutations in the 3′ UTR of mouse Bmf mRNA was introduced by overlap extension PCR. To generate stably expressed cells, RAW264.7 cells were transduced with viral supernatants collected from the HEK293T cells transfected with lentiviral constructs. After 48 h transduction, puromycin (5 μg/ml) was added to the dishes for additional 5 d to screen stably transfected cells, and expression of target genes was verified by immunoblotting.

The pGEM-4Z-1.3HBV plasmid that contains a 1.3-fold over-length of the genotype B HBV genome was obtained from Pei-Jer Chen (Graduate Institute of Clinical Medicine, College of Medicine, National Taiwan University, Taipei, Tanwan).
The coding sequences of HBx, hepatitis B surface (HBs), and hepatitis B core (HBc) were amplified by PCR from the pGEM-4Z-1.3HBV plasmid. HBx, HBs, and HBc genes were amplified and cloned into the pCDH-CMV-MCS-EF1-copGFP vector (System Biosciences, Palo Alto, CA) with EcoRI/NotI, EcoRI /BamHI, or XbalI/EcoRI, respectively. The primers are listed in supplemental Table S1.