Log In Sign up
The largest database of trusted experimental protocols

Abi 3100

Manufactured by Thermo Fisher Scientific
Visit Supplier
Sourced in United States, United Kingdom, Germany

The ABI 3100 is a capillary electrophoresis genetic analyzer that can be used for a variety of applications, including DNA sequencing, fragment analysis, and genotyping. The instrument utilizes a 16-capillary array and four-color fluorescence detection to analyze multiple samples simultaneously.

Automatically generated - may contain errors

Lab products found in correlation

Bigdye terminator v3.1 cycle sequencing kit, by Thermo Fisher Scientific (4 mentions) Hi di formamide, by Thermo Fisher Scientific (3 mentions) Qiaquick pcr purification kit, by Qiagen (3 mentions) Abi prism bigdye terminator cycle sequencing ready reaction kit, by Thermo Fisher Scientific (2 mentions) Genemapper v4, by Thermo Fisher Scientific (2 mentions) Rox 500, by Thermo Fisher Scientific (2 mentions) Trizol, by Thermo Fisher Scientific (2 mentions) Powerup sybr green master mix, by Thermo Fisher Scientific (2 mentions) Abi 3730, by Thermo Fisher Scientific (2 mentions) Bigdye 3, by Thermo Fisher Scientific (2 mentions) Bigdye v3, by Thermo Fisher Scientific (2 mentions) Bigdye terminator sequencing kit, by Thermo Fisher Scientific (2 mentions) Abi 3130 genetic analyzer, by Thermo Fisher Scientific (2 mentions) Pgem t easy vector, by Promega (2 mentions) Pop 7 separation matrix, by Thermo Fisher Scientific (1 mentions) Bionumerics v 5, by BioNumerics (1 mentions) Peak scanner v1, by Thermo Fisher Scientific (1 mentions) Gotaq polymerase, by Promega (1 mentions) 3700 automated sequencer, by Thermo Fisher Scientific (1 mentions) Superscript 3 one step rt pcr kit, by Thermo Fisher Scientific (1 mentions)

75 protocols using abi 3100

1

Fragment Analysis of PCR Products

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
PCR products were analysed on either an ABI 3100 or 3130xl genetic analyser using a 16 capillary 36 cm array with either POP-4 or POP-7 separation matrix (all Life Technologies, Paisley, UK). Genetic analysers were calibrated for the G5 dyeset. GeneScan 1200 LIZ standard was used as internal sizing reference (Life Technologies, Paisley, UK). Fragment analysis samples contained 1 μL amplified DNA, 0.5 μL 1200 LIZ standard and 8.5 μL Hi-Di formamide (Life Technologies, Paisley, UK). Samples were injected at 5 kV for 5 sec and resolved using a separation voltage of 6.5 kV for 103 min. Major peaks in fluorescent signal were imported into BioNumerics v.5.1 software (Applied Maths, Sint-Martens-Latem) to complete the method validation. Fragments were initially sized using either PeakScanner v.1.0 or GeneMapper v.4.0 software (both Life Technologies, Paisley, UK), or were imported into BioNumerics directly. All signals with a height <10% that of the highest peak in the individual profile were excluded (as these were considered background rather than evidence of a major DNA fragment). For peaks <1.5bp different in size, the lower intensity peak was also excluded [18 (link)].
Fawley W.N., Knetsch C.W., MacCannell D.R., Harmanus C., Du T., Mulvey M.R., Paulick A., Anderson L., Kuijper E.J, & Wilcox M.H. (2015). Development and Validation of an Internationally-Standardized, High-Resolution Capillary Gel-Based Electrophoresis PCR-Ribotyping Protocol for Clostridium difficile. PLoS ONE, 10(2), e0118150.
+ Open protocol
+ Expand
2

Microsatellite Instability Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols
Microsatellite instability (MSI) was assessed in 7 tumor samples with loss of expression of MMR proteins by the Molecular Pathology laboratory in Bergonie Institute, Bordeaux (France), using a fluorescent multiplex PCR-based method with a set of five mononucleotide markers (BAT25, BAT26, NR21, NR22, NR24). Polymerase chain reaction (PCR) for the various microsatellite markers was carried out only on tumor DNA. Standard PCR conditions were used. Primers were custom ordered with various fluorescent dyes from life technologies®. The analysis of variability in the length of PCR product corresponding to the microsatellite markers was performed on ABI 3100 (life technologies®). Tumors were classified as MSI-high if >2 of the 5 markers are unstable; microsatellite stable (MSS) when there is an absence of instability and MSI-low if only 1 marker is unstable. This latter is considered as a MSS status.
Sekal M., Ameurtesse H., Chbani L., Ouldim K., Bennis S., Abkari M., Boulouz A., Benajah D.A., Benjelloun B., Ousadden A., Ait Taleb K., Ait Laalim S., Toghrai I., Mazaz K., Arifi S., Mellas N., El Rhazi K., Harmouch T., Ibrahimi S.A, & Amarti Riffi A. (2015). Epigenetics could explain some Moroccan population colorectal cancers peculiarities: microsatellite instability pathway exploration. Diagnostic Pathology, 10, 77.
+ Open protocol
+ Expand
3

Genetic Analysis of IDH1, IDH2 and TP53

Check if the same lab product or an alternative is used in the 5 most similar protocols
Primer pairs were designed to amplify a fragment spanning the catalytic domain of IDH1 including codon 132, IDH2 codon 172, and exons 5–8 of TP53 gene (Table 2). Sequence reactions were performed on an automated sequencer (ABI 3100; Life Technologies, Foster City, CA) using the ABI-PRISM Big-Dye Terminator Cycle Sequencing Ready Reaction kit (Life Technologies, Foster City, CA).
Barbano R., Palumbo O., Pasculli B., Galasso M., Volinia S., D'Angelo V., Icolaro N., Coco M., Dimitri L., Graziano P., Copetti M., Valori V.M., Maiello E., Carella M., Fazio V.M, & Parrella P. (2014). A MiRNA Signature for Defining Aggressive Phenotype and Prognosis in Gliomas. PLoS ONE, 9(10), e108950.
+ Open protocol
+ Expand
4

PCR Amplification and Sequencing Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
PCR amplification was performed using 10 pmol of specific primer, 250 μM dNTPs, 50 ng of genomic DNA, and 1 U GoTaq Polymerase (Promega, Madison, WI) in the buffer provided by the manufacturer. The cycling conditions were 95°C for 20 s, 59°C for 20 s, and 72°C for 20 s. The PCR products were desalted and purified using a PCR product purification kit. The cleaned PCR products were analyzed using a Big Dye Terminator V3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA) following the manufacturer’s instructions. After ethanol purification, the reaction products were analyzed using a sequencer (ABI 3100, Life Technologies, Foster City, California, USA). SNP validation was visually confirmed.
Myung D.S., Lee W.S., Park Y.L., Kim N., Oh H.H., Kim M.Y., Oak C.Y., Chung C.Y., Park H.C., Kim J.S., Cho S.B., Kweon S.S, & Joo Y.E. (2015). Association between interleukin-18 gene polymorphism and Helicobacter pylori infection in the Korean population. Scientific Reports, 5, 11535.
+ Open protocol
+ Expand
5

BRAF Catalytic Domain Amplification

Check if the same lab product or an alternative is used in the 5 most similar protocols
Primer pairs were designed to amplify a fragment spanning the catalytic domain of BRAF including codon 600. Primers sequence was as follows: forward primer, 5′- CATAATGCTTGCTCTGATAG -3′ and reverse primer, 5′- GTAACTCAGCAGCATCTCAG -3′. Sequence reactions were performed on an automated sequencer (ABI 3100; Life Technologies) using the ABI-PRISM Big-Dye Terminator Cycle Sequencing Ready Reaction kit (Life Technologies) and analyzed by BLAST and manual review of chromatograms.
Barbano R., Pasculli B., Coco M., Fontana A., Copetti M., Rendina M., Valori V.M., Graziano P., Maiello E., Fazio V.M, & Parrella P. (2015). Competitive allele-specific TaqMan PCR (Cast-PCR) is a sensitive, specific and fast method for BRAF V600 mutation detection in Melanoma patients. Scientific Reports, 5, 18592.
+ Open protocol
+ Expand
6

Full-Genome Sequencing of Cell Cultures

Check if the same lab product or an alternative is used in the 5 most similar protocols
Full-genome sequencing was completed as described elsewhere (Ciota et al., 2007b (link)) using 9 overlapping primer sets (sequences available upon request). Briefly, RNA was extracted from cell culture supernatant and subjected to reverse transcription (RT) and polymerase chain reactions (PCR) using the SuperScript III one-step RT-PCR kit (Life technologies) and products were concentrated using Zymo-5 DNA spin columns (Zymo Research). Sequencing was completed at the Wadsworth Center Applied Genomics Technology Core on an ABI 3100 or 3700 automated sequencer (Applied Biosystems). Sequences were compiled and edited using the SeqMan module of the DNAStar software package (DNAStar) with a minimum of two-fold redundancy throughout the genome.
Ciota A.T., Payne A.F, & Kramer L.D. (2015). West Nile virus adaptation to ixodid tick cells is associated with phenotypic trade-offs in primary hosts. Virology, 482, 128-132.
+ Open protocol
+ Expand
7

Quantitative PCR mRNA Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted with the RNAeasy Kit (Qiagen, UK) or Trizol (Life Technologies) or Sepazol (Nacalai Tesque) according to the manufacturers’ instructions. First-strand cDNA was synthesized by ReverTra Ace (Toyobo) according to the manufacturer’s instructions; mRNA levels were quantified by qPCR using SYBR Premix Ex Taq (Takara) or PowerUp SYBR Green Master Mix (ThermoFisher Scientific) and the ABI3100 or StepOnePlus system (Applied Biosystems) or MX3000p system (Stratagene), and were normalized to Gapdh. The sequences of the primers are provided in S1 Table.
Ohashi W., Kimura S., Iwanaga T., Furusawa Y., Irié T., Izumi H., Watanabe T., Hijikata A., Hara T., Ohara O., Koseki H., Sato T., Robine S., Mori H., Hattori Y., Watarai H., Mishima K., Ohno H., Hase K, & Fukada T. (2016). Zinc Transporter SLC39A7/ZIP7 Promotes Intestinal Epithelial Self-Renewal by Resolving ER Stress. PLoS Genetics, 12(10), e1006349.
+ Open protocol
+ Expand
8

Genetic Screening for PTPRQ Mutations

Check if the same lab product or an alternative is used in the 5 most similar protocols
Mutation segregation was performed in all family members. Additionally, 328 negative samples and 74 familial patients were also screened for the mutations by direct sequencing. Genotyping for c. 3125 A>G and c.5981 A>G was performed by PCR (primer sequences are available upon request) and detected by bidirectional sequencing of the amplified fragments using an automated DNA sequencer (ABI 3100; Applied Biosystems). Nucleotide alteration(s) were identified by sequence alignment with the PTPRQ GenBank sequence (NM_001145026.1) using the Genetool software.
Gao X., Su Y., Chen Y.L., Han M.Y., Yuan Y.Y., Xu J.C., Xin F., Zhang M.G., Huang S.S., Wang G.J., Kang D.Y., Guan L.P., Zhang J.G, & Dai P. (2015). Identification of Two Novel Compound Heterozygous PTPRQ Mutations Associated with Autosomal Recessive Hearing Loss in a Chinese Family. PLoS ONE, 10(4), e0124757.
+ Open protocol
+ Expand
9

BRCA1/2 Mutation Analysis in Cases

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Genomic DNA was extracted from the participants’ peripheral blood samples. For BRCA1/2 mutation testing in cases, 22 coding exons of BRCA1 and 26 coding exons of BRCA2 were scanned through fluorescence-based conformation sensitive gel electrophoresis (F-CSGE) and denaturing high-performance liquid chromatography (DHPLC). For a subset of PCR products with aberrant patterns, direct sequencing was performed on an ABI3100 or ABI3700 (Applied Biosystems, CA) or a MegaBACE500 (GE Healthcare, UK) genetic analyzer. In this study, the definition of a genetic mutation is restricted to the protein-truncating mutation and the missense mutation, which are known to be associated with the disease. This study also includes the participants with a clinically unverified mutation in BRCA1/2 genes. More detailed information about BRCA1/2 mutation analysis has been described before31 (link),37 (link). Since this study also includes the cases with unverified mutation on BRCA1/2, we examined whether non-pathogenic variants on these genes are more frequent in the cases compared to controls at p-value of 0.05. And we searched them at the ClinVar database.
Lee J.Y., Kim J., Kim S.W., Park S.K., Ahn S.H., Lee M.H., Suh Y.J., Noh D.Y., Son B.H., Cho Y.U., Lee S.B., Lee J.W., Hopper J.L, & Sung J. (2018). BRCA1/2-negative, high-risk breast cancers (BRCAX) for Asian women: genetic susceptibility loci and their potential impacts. Scientific Reports, 8, 15263.
+ Open protocol
+ Expand
10

Investigating GPR126 Alternative Splicing

Check if the same lab product or an alternative is used in the 5 most similar protocols
GPR126 contains 26 exons and alternative splicing of exon 6 and exon 25 produces 4 protein-coding transcripts. We suspect that some SNPs in GPR126 may regulate the alternative splicing and finally alter the protein function of GPR126. Genomic DNA was extracted from peripheral blood of patients using the TIANamp Genomic DNA Kit (TIANGEN, China). The SNPs around exon 6 and exon 25 associated with splicing were analyzed. Sequencing primers: exon 6-F: 5′-TCTTTTGACAGACTCAGGAAACCA-3′; exon 6-R: 5′- AACTTGTTTCCTGCAGCAAATAAT-3′; exon 25-F: 5′- CTCAAACTCCTGGGCTCAAG -3′; exon 25-R: 5′- TCCTAGAAGGAGCCGCTTGC-3′. We also identified the genotype of rs6570507 by sequencing: primer: rs6570507-F: 5′-GAAAGATTTTCTGTGACATTCTC-3′; rs6570507-R: 5′-TGGTCAGGCTGGTCTCAA-3′. PCR conditions were set as follows: 1 min initial denaturation at 94°C, 30 cycles of 15 s denaturation at 94°C, 10 s annealing at 58°C, 1min extension at 72°C, and 10 min final extension at 72°C. The PCR products were analyzed using the sequencing system ABI3100 (Applied Biosystems).
Xu E., Shao W., Jiang H., Lin T., Gao R, & Zhou X. (2019). A Genetic Variant in GPR126 Causing a Decreased Inclusion of Exon 6 Is Associated with Cartilage Development in Adolescent Idiopathic Scoliosis Population. BioMed Research International, 2019, 4678969.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!