Monosodium glutamate (G1626, Sigma) was dissolved in sterile isotonic saline (0.9% saline). 17β-estradiol (E-2758, Sigma) was dissolved in ethanol and diluted to 10% in sterile saline immediately before administration. Genistein (253493, J&K Scientific, Beijing, China) was dissolved in 5% dimethyl sulfoxide and 95% polyethylene glycol 400.
Monosodium glutamate g1626
Manufactured by Merck Group
Monosodium glutamate (G1626) is a laboratory reagent produced by Merck Group. It is a white crystalline powder that is soluble in water. Monosodium glutamate is used as a food additive and in various scientific applications.
Automatically generated - may contain errors
2 protocols using monosodium glutamate g1626
1
Preparation of Bioactive Compounds
2
Modulating Capicua Expression in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
pCMV5 HA Capicua was purchased from MRC-PPU. For stable CIC expression, the CIC cDNA was subcloned into lentiviral vector (Flag-tagged) using Gateway system. CIC S173A mutant was generated using site-directed mutagenesis. Two independent oligos targeting CIC (sgCIC1: GCTCAGACACCAAGGCTCCG, sgCIC2: CCCCTCCGTGCAGCCGAGCG) were constructed and ligated into lentiCRISPR v2 (Addgene plasmid #52,961) for CIC depletion. pLenti CMV-SLC7A11-sh926R-FLAG-IRES-Hygro (Addgene plasmid #118,702) was used for xCT overexpression. The following reagents were used for in vitro treatments: monosodium glutamate (G1626, Sigma), R18 (2144, TOCRIS) and ( +)-MK801 maleate (HB0004, Hellobio).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!