Total RNA was extracted from cultured cells by using the Rneasy MiNi kit (Qiagen GmbH, Hilden, Germany), and then dissolved in diethylpyrocarbonate-treated (DEPC) water according to the manufacturer's instructions. cDNA was then synthesized using the Takara Reverse Transcription System Kit (Takara Biotechnology Co. Ltd., Japan), as described by the protocol. Real time quantitative RT-PCR were performed by using the Sybr green premix kit (BioRad, Hercules, California, USA). The GAPDH gene was used as a control housekeeping gene. All reactions were reproduced in triplicate.
Sybr green premix kit
Manufactured by Bio-Rad
Sourced in United States
The Sybr green premix kit is a ready-to-use solution containing Sybr green dye, designed for quantitative real-time PCR (qPCR) analysis. The kit provides the necessary components for DNA amplification and real-time detection, simplifying the setup and execution of qPCR experiments.
Automatically generated - may contain errors
7 protocols using sybr green premix kit
1
Quantitative RT-PCR Analysis of Gene Expression
2
Quantitative RT-PCR Analysis of Wnt Pathway
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cultured cells using Trizol reagent (Invitrogen, Carlsbad, CA) and dissolved in diethylpyrocarbonate treated (DEPC) water. cDNA was synthesized using the Takara Reverse Transcription System Kit (Takara Biotechnology Co. Ltd., Kusatsu, Japan) according to the manufacturer's instruction. Real‐time quantitative RT‐PCR was performed using the Sybr green premix kit (BioRad, Hercules, FL). All reactions were done in triplicates. GAPDH was used as a housekeeping gene. The following primers are used in this assay: Fasn—sense AAGGACCTGTCTAGGTTTGATGC and antisense TGGCTTCATAGGTGACTTCCA; Wnt5a—sense ATTCTTGGTGGTCGCTAGGTA and antisense CGCCTTCTCCGATGTACTGC; Wnt5b—sense CGCTTCGCCAAGGAGTTTG and antisense TGCCATCTTATACACAGCCCT; Fzd2—sense GTGCCATCCTATCTCAGCTACA and antisense CTGCATGTCTACCAAGTACGTG; GAPDH—sense ACAACTTTGGTATCGTGGAAGG and antisense—GCCATCACGCCACAGTTTC.
3
Quantitative Analysis of EMT Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cultured cells using Trizol reagent (Invitrogen, Carlsbad, CA) and dissolved in diethylpyrocarbonate treated (DEPC) water. cDNA was synthesized using the Takara Reverse Transcription System Kit (Takara Biotechnology Co. Ltd., Japan) according to the manufacturer's instruction. Real time quantitative RT-PCR was performed using the Sybr green premix kit (BioRad, Hercules, CA, USA). GAPDH was used as a housekeeping gene. The following primers are used in this assay: SDHB: sense GACACCAACCTCAATAAGGTCTC, and anti-sense GGCTCAATGGATTTGTACTGTGC; Snail1: sense TCGGAAGCCTAACTACAGCGA, and anti-sense AGATGAGCATTGGCAGCGAG; Smad3: sense CCATCTCCTACTACGAGCTGAA, and anti-sense CACTGCTGCATTCCTGTTGAC; Smad4: sense CTCATGTGATCTATGCCCGTC, and anti-sense AGGTGATACAACTCGTTCGTAGT; ZO1: sense ACCAGTAAGTCGTCCTGATCC, and anti-sense TCGGCCAAATCTTCTCACTCC; E-cadherin: sense CGAGAGCTACACGTTCACGG, and anti-sense GGGTGTCGAGGGAAAAATAGG; N-cadherin: sense TGCGGTACAGTGTAACTGGG, and anti-sense GAAACCGGGCTATCTGCTCG; Fibronectin: sense CGGTGGCTGTCAGTCAAAG, and anti-sense AAACCTCGGCTTCCTCCATAA; GAPDH: sense ACAACTTTGGTATCGTGGAAGG, and anti-sense GCCATCACGCCACAGTTTC.
4
qRT-PCR Analysis of SDHB and miR-96-3p
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA extractions from cell lines and frozen tissue specimens were conducted with TRIzol® reagent (Invitrogen). The Takara Reverse Transcription System Kit (Takara Biotechnology Co. Ltd, Japan) were used to synthesize cDNA. The quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) was performed using the SYBR green premix kit (BioRad, Hercules, CA, USA). GAPDH and U6 was used as internal controls for SDHB and miR-96-3p respectively. The sequences of the primers were as follows:
MiR-96-3p: 5′-GCCCGCTTTGGCACTAGCACATT-3′ (Forward); 5′-GTGCAGGGTCCGAGGT-3′ (Reverse). SDHB: 5′-GACACCAACCTCAATAAGGTCTC-3′ (Forward); 5′-GGCTCAATGGATTTGTACTGTGC-3′ (Reverse). GAPDH: 5′-GGCACAGT-CAAGGCTGAGAATG-3′ (Forward), 5′-ATGGTGGTGAAGACGCCAGTA-3′ (Forward).
MiR-96-3p: 5′-GCCCGCTTTGGCACTAGCACATT-3′ (Forward); 5′-GTGCAGGGTCCGAGGT-3′ (Reverse). SDHB: 5′-GACACCAACCTCAATAAGGTCTC-3′ (Forward); 5′-GGCTCAATGGATTTGTACTGTGC-3′ (Reverse). GAPDH: 5′-GGCACAGT-CAAGGCTGAGAATG-3′ (Forward), 5′-ATGGTGGTGAAGACGCCAGTA-3′ (Forward).
5
Trizol RNA Extraction and qRT-PCR for SIRT1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA extractions frozen tissue specimens were conducted with TRIzol® reagent (Invitrogen). The Takara Reverse Transcription System Kit (Takara Biotechnology Co. Ltd, Japan) were used to synthesized cDNA. The quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) was performed using the SYBR green premix kit (BioRad, Hercules, CA, USA). GAPDH was used as internal controls. The primer sequences were as the following. SIRT1 Forward: ACCTCCTCATTGTTATTGGGTCTTC, Reverse: GGCATACTCGCCACCTAACC.
6
Quantification of Gene Expression by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cultured cells using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.). The RNA was reverse-transcribed at 42°C for 40 min into cDNA using the Takara Reverse Transcription system kit (Takara Bio, Inc., Otsu, Japan), according to the manufacturer's protocol. qPCR was performed using the SYBR Green Premix kit (Bio-Rad Laboratories, Inc., Hercules, CA, USA), according to the manufacturer's protocol. GAPDH was used as an internal reference gene. The following primers were used: Lasp-1, 5′-GCTTCCATTGCGAGACCTG-3′ (forward) and 5′-TGCCACTACGCTGAAACCT-3′ (reverse); ERK1/2, 5′-GTGCCGTGGAACAGGTTGT-3′ (forward) and 5′-ATGGGCTCATCACTTGGGT-3′ (reverse); and GAPDH 5′-TGTTCGTCATGGGTGTGAAC-3′ (forward) and 5′-ATGGCATGGACTGTGGTCAT-3′ (reverse). qPCR was performed on target genes under the following conditions: 95°C for 2 min, 35 cycles of 94°C for 30 sec, 58°C for 45 sec and 72°C for 35 sec. Data were collected and calculated for CT values of all samples and standards based on fluorescent quantification using GAPDH as the baseline. Standard curve was firstly plotted using CT values of standards, followed by semi-quantitative analysis by 2−ΔΔCq method (24 (link)).
7
Quantification of Cell Death Regulators
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cultured cells using Trizol reagent (Invitrogen, Carlsbad, California, USA) and dissolved in diethylpyrocarbonate treated (DEPC) water. cDNA was synthesized using the Takara Reverse Transcription System Kit (Takara Biotechnology Co. Ltd., Japan) according to the manufacturer's instruction. Real time quantitative RT-PCR was performed using the Sybr green premix kit (BioRad). TPT-1 was used as a housekeeping gene. The following primers are used in this assay:RIPK1 :sense TGGGCGTCATCATAGAGGAAG, and anti-sense CGCCTTTTCCATGTAAGTAGCA; RIPK3: sense AATTCGTGCTGCGCCTAGAAG,and anti-sense TCGTGCAGGTAAAACATCCCA; MLKL: sense AAGCTTGCAGGATTTGAGTTGA , and anti-sense CAGAGGACGATTCCAAAGCTGT;IL-1α:sense AGATGCCTGAGATACCCAAAACC, and anti-sense CCAAGCACACCCAGTAGTCT;IL-6:sense ACTCACCTCTTCAGAACGAATTG, and anti-sense CCATCTTTGGAAGGTTCAGGTTG. The PCR conditions were as following: 95℃for 3 min followed by 40 cycles at 95℃ for 10 s and 55℃for 30 s. All reactions were performed in triplicate both biologically and technically.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!