Lightcycler

Total RNA was extracted from cultured cells using TRIzol reagent (Invitrogen). Reverse transcription was carried out using PrimerScript Reverse Transcriptase. Real-time quantitative PCR was performed using Roche LightCycler^® 480 system with SYBR Green reagents (Takara). The results were determined by the 2^−ΔΔCt method to compare gene expression with GAPDH expression as a loading control. Primer sequences were as follows: LAMP2A forward: 5′-GCACAGTGAGCACAAATGAGT-3′; reverse: 5′-CAGTGGTGTGTATGGTGGGT-3′. GAPDH forward: 5′-GCACAGTGAGCACAAATGAGT-3′, reverse: 5′-CAGTGGTGTGTATGGTGGGT-3′.

Total RNA from samples was extracted with a TRIzol RNA extraction kit (Invitrogen Co.). Reverse transcription was performed with a Rever Tre Ace-a-reverse transcription kit (Invitrogen Co.) to synthesize complementary DNA. The RT–PCR was performed with a Roche LightCycler using Takara SYBR Premix Extaq system. All preforming procedures were followed the instructions of manufactures. Primers were generated by Shanghai Sangon Biological Engineering Technology Services Co., Ltd. The nucleotide sequences of each primer presented in supplementary Table 1.

Total RNAs were extracted from liver tissues using Ribospin II extraction kit (GeneAll Biotechnology, Seoul, Korea) following the manufacturer's protocol without modification. One microgram of the RNA was used to synthesize complementary DNAs using a ReverTra Ace® qPCR RT Master Mix reagent and a T100TM Bio‐Rad Thermal Cycler (Hercules, CA, USA) at 37℃ for 15 min, according to the manufacturer's instructions. PCR was performed using a SYBR Premix Ex Taq^TM (Takara, Shiga, Japan) and a Light Cycler (Takara). The reaction mixture for the PCR assay consisted of 0.0125 ml of TB Green Premix Ex Taq; 0.002 ml of forward and reverse primers for GAPDH (F: ggctacactgaggaccaggtsequences; R: tccaccaccctgttgctgta), COX‐2 (F: atactggaagccgagcacct; R: gtgggaggcacttgcattga), IL‐17 (F: tgtcaatgcggagggaaagc; R: ccacacccaccagcatcttc), and iNOS (F: cggagtgacggcaaacatga; R: ttccagcctaggtcgatgca); 0.002 ml of cDNA; and 0.0085 ml of distilled water. The thermal profile of the assay was as follows: 95℃ for 5 min, 40 cycles of 95℃ for 30 s and 62℃ for 30 s. All samples were run in triplicate, and the fluorescence data of target genes were analyzed with the 2−ΔΔCt method for relative quantification using GAPDH as an internal control.

Total RNAs were isolated from cells by using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). For cDNA synthesis, RT reaction was performed by incubating 200 ng of total RNA with a reaction mixture containing 0.5 μg/μL oligo dT_12–18 and GoScript RT (Promega, Madison, WI, USA). Real-time reverse transcriptase (RT)-polymerase chain reaction (PCR) analysis was performed using a Roche LightCycler (Mannheim, Germany) with the Takara SYBR Premix ExTaq system (Otsu, Japan) as described previously [30 (link)]. The relative expression level of each gene was normalized using the housekeeping gene hypoxanthine-guanine phosphoribosyltransferase (HPRT) or GAPDH. Primer sequences for NRF2, NQO1, the modulatory subunit of GCL (GCLM), AKR1c1, and HPRT are described in our previous study [29 (link)]. Primers for the human X-binding protein-1 (XBP-1) are as follows: 5′-CCTGGTTGCTGAAGAGGAGG-3′ and 5′-CCATGGGGAGATGTTCTGGAG-3′. PCR amplification for XBP1 gene was carried out with a thermal cycler (Bio-Rad, Hercules, CA, USA) and amplification conditions were 40 cycles of 40 s at 95°C, 30 s at 56°C and 30 s at 72°C. PCR products were resolved on 3% agarose gels and the images were captured by using a Gel Doc EZ Imager (Bio-Rad, Hercules, CA, USA). All primers were synthesized by Bioneer (Daejeon, South Korea).