FISH analysis was performed as described previously [8 (link)]. In brief, a digoxigenin-labeled probe specific for a mouse major satellite sequence and a biotin-labeled probe specific for the neomycin-resistance gene or human Cot-1 DNA (ThermoFisher Scientific) were prepared using Nick Translation Mix (Roche). The TSA Biotin Kit (PerkinElmer) was used to enhance the signal generated by the neomycin-resistance gene probe. Samples were counterstained with 4´,6-diamidino-2-phenylindole (DAPI) to visualize genomic DNA.
Nick translation mix
Manufactured by Roche
Sourced in Germany
Nick Translation Mix is a laboratory reagent used to label DNA or RNA samples with radioactive or fluorescent markers. It provides the necessary enzymes, buffers, and reagents to perform the nick translation reaction, which incorporates labeled nucleotides into the target nucleic acid.
Automatically generated - may contain errors
Lab products found in correlation
Tetramethyl rhodamine 5 dutp, by Roche (3 mentions)
Tsa biotin kit, by PerkinElmer (2 mentions)
Gotaq reaction buffer, by Promega (2 mentions)
Taq polymerase, by Promega (2 mentions)
Fluorescein 12 2 deoxy uridine 5 triphosphate, by Roche (2 mentions)
Axiovision software, by Zeiss (2 mentions)
Cot 1 dna, by Thermo Fisher Scientific (1 mentions)
Dm5500b microscope, by Leica (1 mentions)
Vectashield, by Vector Laboratories (1 mentions)
Texas red 5 dutp, by Thermo Fisher Scientific (1 mentions)
Alexa fluor 488 5 dutp, by Thermo Fisher Scientific (1 mentions)
4 6 diamidino 2 phenylindole (dapi), by Southern Biotech (1 mentions)
Pcr extraction kit, by Qiagen (1 mentions)
Pgem t easy vector, by Promega (1 mentions)
Slowfade, by Thermo Fisher Scientific (1 mentions)
Axioimager 2 epifluorescence microscope, by Zeiss (1 mentions)
Digoxigenin 11 dutp dig dutp, by Roche (1 mentions)
Hybond, by Cytiva (1 mentions)
Ci s fl fluorescence microscope, by Nikon (1 mentions)
Anti digoxigenin antibody, by Vector Laboratories (1 mentions)
26 protocols using nick translation mix
1
Fluorescent In Situ Hybridization Analysis
2
Cytogenetic Analysis of Cloned Satellite DNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cloned satellite DNAs, rDNAs, and retrotransposons were labeled with either Cy3-dUTP, Cy5-dUTP, or digoxigenin-11-dUTP by nick translation using a nick translation mix (Roche, Brazil) or with DNase I (0.002 U) and DNA polymerase (4 U) enzymes following Kato et al. (2004) (link). 35S rDNA sites were detected with the pTa71 clone from Triticum aestivum (Gerlach and Bedbrook, 1979 (link)). Clone D2 from Lotus japonicus (Pedrosa et al., 2002 (link)) was used to detect the 5S rDNA.
Chromosomes were prepared from root tips collected from bulbs, pretreated in 0.02 M 8-hydroxyquinoline at 10°C for 24 h and fixed in ethanol: acetic acid (3:1 v/v) for 2 to 24 h at room temperature and stored at −20°C. Fixed root tips were digested with 2% cellulase-20% pectinase for 90 min at 37°C, and squashed in a drop of 45% acetic acid. Fluorescent in situ hybridization was performed as described by Pedrosa et al. (2002) (link). The hybridization mix contained 50% (v/v) formamide, 10% (w/v) dextran sulfate, 2× SSC, and 5 ng/µL of each probe. Slides were denatured at 75°C for 5 min, and the final stringency of hybridization was 76%.
Images were captured using a Leica DM5500 B microscope with a Leica DFC345 FX coupled camera and the LAS AF software. Images were edited with Adobe Photoshop CS5.
Chromosomes were prepared from root tips collected from bulbs, pretreated in 0.02 M 8-hydroxyquinoline at 10°C for 24 h and fixed in ethanol: acetic acid (3:1 v/v) for 2 to 24 h at room temperature and stored at −20°C. Fixed root tips were digested with 2% cellulase-20% pectinase for 90 min at 37°C, and squashed in a drop of 45% acetic acid. Fluorescent in situ hybridization was performed as described by Pedrosa et al. (2002) (link). The hybridization mix contained 50% (v/v) formamide, 10% (w/v) dextran sulfate, 2× SSC, and 5 ng/µL of each probe. Slides were denatured at 75°C for 5 min, and the final stringency of hybridization was 76%.
Images were captured using a Leica DM5500 B microscope with a Leica DFC345 FX coupled camera and the LAS AF software. Images were edited with Adobe Photoshop CS5.
3
Investigating Centromere Localization in Trypanosoma brucei
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Trypanosoma brucei procyclics were fixed in 4% paraformaldehyde and 4% acetic acid, air-dried on microscope immunofluorescence slides and dehydrated in serial ethanol baths (50–100%). Probes were labelled with tetramethyl-rhodamine-5-dUTP® (Roche) by using the Nick Translation Mix® (Roche). Slides were then hybridized with a heat-denatured DNA probe under a sealed rubber frame at 94°C for 2 min and then overnight at 37°C. The hybridization solution contained 50% formamide, 10% dextran sulfate, 2X SSPE, 250-mg/ml salmon sperm DNA and 100 ng of labelled double strand DNA probe. After hybridization, parasites were sequentially washed in 50% formamide-2 X SSC at 37°C for 30 min, 2X SSC at 50°C for 10 min, 2X SSC at 60°C for 10 min and 4X SSC at room temperature. Slides were finally mounted in Vectashield (Vector Laboratories) with DAPI and microscopically examined; more than 200 cells per transfected strain were counted. For statistical analysis of centromere localization, data for 200 cells were compared using the chi-square test. After inhibition of TbMlp2 by RNAi, the number of copies of chromosome 1 was determined by using DNA probes targeting the alpha- and beta-tubulin genes (55 (link)).
4
Genomic DNA Extraction and Multicolor GISH Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total genomic DNA was extracted from fresh leaves using a modified CTAB method (Allen et al., 2006 (link)) with one additional purification step to obtain high-quality DNA. The total genomic DNA of Th. ponticum was labeled with Red-5-dUTP (Invitrogen) by nick translation (Nick Translation Mix, Roche). Genomic DNA of CS was fixed in boiling water for 5 min and used as a blocker at a ratio of 1:300. The GISH procedure was performed as described in Fu et al. (2012) (link). For multicolor GISH (mc-GISH) analysis, Th. bessarabicum DNA was labeled with Alexa Fluor 488-5-dUTP (Invitrogen), and Ps. spicata DNA was labeled with Texas Red-5-dUTP (Invitrogen) (Wang et al., 2019 (link)).
The oligonucleotide probes used to identify wheat and Th. ponticum chromosomes by non-denaturing FISH (ND-FISH) analysis included Oligo-pSc119.2 (6-FAM-5′), Oligo-pTa535 (Tamra-5′) (Tang et al., 2014 (link)), Oligo-44 (6-FAM-5′), and Oligo-D (6-FAM-5′) (Tang et al., 2018 (link)), all of which were synthesized by Shanghai Invitrogen Biotechnology Co. Ltd. (Shanghai, China). Chromosomes were counterstained with 4,6-diamidino-2-phenylindole (DAPI). Fluorescent signals were scanned and photographed with an Olympus BX53 microscope equipped with a Photometrics SenSys CCD DP80 camera (Japan) (Wang et al., 2016 (link)).
The oligonucleotide probes used to identify wheat and Th. ponticum chromosomes by non-denaturing FISH (ND-FISH) analysis included Oligo-pSc119.2 (6-FAM-5′), Oligo-pTa535 (Tamra-5′) (Tang et al., 2014 (link)), Oligo-44 (6-FAM-5′), and Oligo-D (6-FAM-5′) (Tang et al., 2018 (link)), all of which were synthesized by Shanghai Invitrogen Biotechnology Co. Ltd. (Shanghai, China). Chromosomes were counterstained with 4,6-diamidino-2-phenylindole (DAPI). Fluorescent signals were scanned and photographed with an Olympus BX53 microscope equipped with a Photometrics SenSys CCD DP80 camera (Japan) (Wang et al., 2016 (link)).
5
FISH Analysis of MI-MAC in Metaphase and Interphase
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
FISH analysis was performed by standard protocols (Tomizuka et al. 1997 (link)). Briefly, fixed cells containing the MI-MAC at metaphase or interphase were spread on slides, and hybridised with biotin-labelled and digoxigenin-labelled probes in a nick translation mix (Roche, Germany). Chromosomal DNA was counterstained with 4′,6-diamidino-2-phenylindole (Southern Biotech, USA). Images were captured with ISIS (Carl Zeiss, Germany).
6
Localization of rDNA clusters in Trifolium
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To localize the clusters of 26S rDNA and 5S rDNA, sequence lengths of 899 bp from Arabidopsis thaliana (L.) Heynh. (X52320.1, GenBank) and 117 bp from T. repens (AF072692.1, GenBank), respectively, were used for primers design. Selected rDNA sequences were amplified using specific primers (26S_F: TTCCCACTGTCCCTGTCTACTAT, 26S_R: GAACGGACTTAGCCAACGACA; 5S_F: GGTGCGATCATACCAGCACTAA, 5S_R: GAGGTGCAACACAAGGACTTC) by polymerase chain reaction (PCR). The PCR mixture contained: 1× GoTaq Reaction Buffer (Promega, Madison, WI, USA), 0.2 mM dNTPs, 1 μL primers, 0.5 U Taq Polymerase (Promega, Prague, Czech Republic), and 20 ng of gDNA (T. pratense var. Tatra). PCR products were separated by electrophoresis in 3% agarose gel, excised from the gel, purified using a PCR extraction kit (Qiagen, Hilden, Germany), then quantified using a NanoDrop 2000c spectrophotometer (Thermo Scientific). Probes were labelled by nick translation using biotin and digoxigenin Nick Translation Mix (Roche, Mannheim, Germany).
7
PRKCI Copy Number Analysis in Ovarian Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
FISH analyses of ovarian cancer subtypes were used to determine the frequency of PRKCI copy number gain. Tissue microarrays were purchased from the Dana-Farber/Harvard Cancer Center Research Pathology Core or US Biomax. FISH was performed according to standard protocols with a few modifications. Briefly, immediately before protease treatment, slides were treated with 1% NaBH4 for 4 h at room temperature to quench endogenous autofluorescence. BAC clone RP11-81K8 was used to generate the PRKCI probe. Using BAC DNA as a template, 14 PCR products were designed, covering a 25-kb sequence across the PRKCI gene. Amplicon DNA was labeled by nick translation mix (Roche Diagnostics). Centromere-specific probe CEP 3(D3Z1) (Abbott Laboratories) served as a ploidy reference. FISH signal evaluation and image acquisition were performed manually using filter sets and software developed by Applied Spectral Imaging.
8
Genomic DNA Extraction and GISH Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was isolated from male adults of R. bonariensis by standard phenol-chloroform –isoamyl alcohol extraction. Labeling was performed using a nick translation mix (Roche Diagnostics GmbH, Mannheim, Germany). DNA was labeled with Cy3-dCTP (red). GISH was essentially performed following the published procedure [47 (link)] for comparative genomic hybridization (CGH), except for the probe cocktail. For one slide, the cocktail contained 300 ng of labeled male gDNA of R. bonariensis, 3 μg of unlabeled sonicated male gDNA of R. bonariensis, and 25 μg of sonicated salmon sperm DNA in 83.5 μL of hybridization solution.
9
Fluorescent Labeling of rDNA and Microsatellite Probes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 5S rDNA probe included 120 base pairs (bp) of the 5S rDNA gene coding region and the 200 bp long non-transcribed spacer (NTS) (Pendás et al., 1994 (link)). The 18S rDNA probe corresponded to a 1,400-bp-long segment of the 18S rDNA coding region (Cioffi et al., 2009 (link)). The 18S and 5S rDNA probes were directly labeled with the Nick-Translation Mix (Roche, Mannheim, Germany) – 18S rDNA with Spectrum Green-dUTP and 5S rDNA with Spectrum Orange-dUTP (both Vysis, Downers Grove, USA), according to the manufacturer’s instructions. (CA)15 and (GA)15 microsatellite probes were directly labeled with Cy3 during the synthesis according to Kubát et al. (2008) (link).
10
FISH Analysis of Genomic DNA Localization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
FISH analysis was performed on either fixed metaphase or interphase nuclei, as described previously with slight modification [4] (link). Briefly, digoxigenin-labeled human Cot-1 (Life Technologies) and specific biotin-labeled probes were prepared with Nick Translation Mix (Roche). Template DNAs for mouse major satellite sequence and TdTomato were prepared by PCR amplification. For mouse major satellite sequence, two copies of mouse major satellite sequence cloned into the pGEMT Easy Vector (Promega) were used as a PCR template. After hybridization, the TSA Biotin Kit (PerkinElmer) was used to enhance the signal of specific probes but not the major satellite sequence. Samples were counterstained with 4′,6-diamidino-2-phenylindole (DAPI) to visualize genomic DNA.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!