Genomic DNA samples were extracted from 1.5 ml of whole blood. Target gene fragments of single nucleotide polymorphisms (SNPs) were amplified by the polymerase chain reaction (PCR), which was performed as detailed in our previous study (Fan et al., 2020 (link)). The following SNPs were selected for genotyping by reviewing the pharmacogenetic studies related to ABC transporters, VPA metabolism, nuclear receptors, and the efficacy of VPA treatment (Kwan et al., 2009 (link); El-Khodary et al., 2012 (link); Nakashima et al., 2015 (link); Queckenberg et al., 2015 (link); Li et al., 2016 (link); Talwar et al., 2017 (link); Chen et al., 2018 (link); Margari et al., 2018 (link); Wang et al., 2018 (link); Xu et al., 2018 (link); Al-Eitan et al., 2019 (link); Chouchi et al., 2019 (link); Shi et al., 2019 (link); Liu et al., 2020 (link); Makowska et al., 2021 (link)). Genotyping of all polymorphisms was carried out using Sequenom MassArray System (Agena Bioscience, San Diego, CA, United States) and iPLEX® Gold Assay. The MassArray Typer 4.0 software was used for data acquisition and analysis. All SNPs were calculated to confirm if they were in Hardy–Weinberg equilibrium.
Iplex gold assay
Manufactured by Agena
Sourced in United States
The IPLEX® Gold Assay is a versatile laboratory equipment designed for the analysis and quantification of precious metals. It utilizes advanced spectroscopic techniques to accurately measure the concentration of gold and other valuable elements in a wide range of samples. The core function of the IPLEX® Gold Assay is to provide reliable and precise analytical results for industrial, research, and academic applications.
Automatically generated - may contain errors
8 protocols using iplex gold assay
1
Genotyping of Pharmacogenetic Variants in ABC Transporters and VPA Metabolism
2
Multiplex Genotyping of FH Mutations
Check if the same lab product or an alternative is used in the 5 most similar protocols
The FH mutations to be studied were selected according to the known mutation frequencies from our previous study
9)
. Sequences covering the selected alterations were taken from the databases of the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/) and Ensembl (http://www.ensembl.org/ index.html).
The entire multiplex reaction process was performed according to the manufacturer’s instructions, including PCR amplification, shrimp alkaline phosphatase treatment, and primer extension reaction using the iPLEX Gold assay (Agena Bioscience, San Diego, California), which have been described in detail before
9)
. Briefly, genomic DNA was amplified via multiplex PCR (PCR Accessory and Enzyme Kit; Agena Bioscience) and unincorporated dNTPs were deactivated. The single-base extension reaction, consisting of the iPLEX enzyme, terminator mix, and extension primer mix, were subject to thermocycling conditions (iPLEX Gold Kit; Agena Bioscience). After desalting, the PCR products were spotted on SpectroCHIP II arrays using a MassARRAY nanodispenser and analyzed using the MassARRAY platform. Mass signals for the different alleles were captured with high accuracy by MALDI-TOF MS, and Typer v4.0 (Agena Bioscience) was used to process the raw data obtained from the assays.
+ Expand
The FH mutations to be studied were selected according to the known mutation frequencies from our previous study
The entire multiplex reaction process was performed according to the manufacturer’s instructions, including PCR amplification, shrimp alkaline phosphatase treatment, and primer extension reaction using the iPLEX Gold assay (Agena Bioscience, San Diego, California), which have been described in detail before
3
Peripheral Blood DNA Genotyping
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total DNA from peripheral blood was extracted using the High Pure PCR Template Preparation kit (Roche Diagnostics GmbH, Mannheim, Germany). Next, DNA samples were genotyped at the Spanish National Genotyping Center (CeGen; http://www.cegen.org ) by the Agena Bioscience’s MassARRAY platform (San Diego, CA, USA) using the iPLEX® Gold assay design system.
4
Pharmacogenomic Genotyping of Candidate Genes
5
Assessing RELN Promoter Methylation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To assess CpG island DNA methylation, 5 mL of peripheral venous blood was taken from each participant and placed into a vacuum blood collection tube containing ethylenediaminetetraacetic acid as an anticoagulant, and was then stored at −20°C. The levels of CpG island methylation in the RELN promoter region in peripheral blood were detected using the iPLEX Gold Assay (Agena Bioscience, San Diego, USA) on the MassARRAY platform (Agena Bioscience). Samples with specific polymerase chain reaction (PCR) amplification products by both methylated and non-methylated primers were identified as positive (i.e., CpG island methylated) specimens. Only the samples of PCR products amplified by unmethylated primers were identified as negative (CpG island unmethylated). The positive rates of CpG island DNA methylation were compared between the experimental and control groups and between patients with type I and II schizophrenia.
6
Genotyping of GABRG2 rs211037 Variant
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA samples were extracted from 1.5 mL of whole blood in all participants. The polymerase chain reaction was performed as described in detail in our previous study.29 (link) Genotyping of GABRG2 rs211037 was carried out using iPLEX® Gold Assay and Sequenom MassArray System (Agena Bioscience, San Diego, CA, United States). The MassArray Typer 4.0 software was used for data acquisition and analysis. The genotyping primers of GABRG2 C>T rs211037 (forward primer sequence: ACGTTGGATGTACCATCTTGGCTTCTGGTGR and reverse primer sequence: ACGTTGGATGAGCTTCTGTCTGTCAGGTCGE) were specifically synthesized in our study.
7
CD14 rs2569190 Polymorphism Genotyping
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from whole blood using High Pure PCR Template Preparation kit (Roche Diagnostics GmbH, Mannheim, Germany). CD14 rs2569190 polymorphism was genotyped at the Spanish National Genotyping Center (CeGen; http://www.cegen.org/ ). Genotyping was performed by Agena Bioscience’s MassARRAY platform (San Diego, CA, USA) using the iPLEX® Gold assay design system. Duplicated samples were included on each plate to check for technical replicates and negative and positive controls were used on each batch to exclude DNA contamination and ensure a technically correct laboratory process.
8
Genotyping of Candidate SNPs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Candidate SNPs from the exploration cohort, as well as a 7 wild-card SNPs not included on the Cardio-Metabo chip, were genotyped using the Agena Biosciences MassARRAY ® platform (formerly Sequenom). SNP multiplexes were designed using Assay Design Suite v.1.0 software (Agena Bioscience, San Diego, CA, US). Genotyping was performed according to the manufacturer's protocol using IPLEX Gold assay (Agena Bioscience, San Diego, CA, US) and analyzed using the MassARRAY Analyzer 4 platform. Mass signals for the different alleles were captured with high accuracy by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). Genotype clustering and individual sample genotype calls were generated using Sequenom TyperAnalyzer v.4.0 software (Agena Bioscience, CA, US).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!