The largest database of trusted experimental protocols

Pcdna4 vps34 flag

Manufactured by Addgene
Sourced in United States

The pcDNA4-VPS34-FLAG is a plasmid vector that expresses the VPS34 protein with a FLAG tag. VPS34 is a phosphoinositide 3-kinase that plays a role in the regulation of various cellular processes, including autophagy and endocytosis. The FLAG tag allows for the detection and purification of the expressed VPS34 protein.

Automatically generated - may contain errors

6 protocols using pcdna4 vps34 flag

1

Molecular Cloning of Autophagy Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols
The Myc-DDK-tagged mouse Msr1 ORF clone (Cat# MR205384), Atg12 (Cat# MR200886), Atg5 (Cat# MR203691), Atg16l1 (Cat# MR209513), Atg9a (Cat# MR208753), Atg13 (Cat# MR207683) and, p62/Sqstm1 (Cat# MR226105), human MSR1 (Cat# RC209609) and Beclin 1 (Cat# MR207162) were obtained from Origene (Rockville, MD 20850, USA). pcDNA-FLAG-Ulk1 (Plasmid # 27636)62 (link) and pcDNA4-VPS34-FLAG (Plasmid # 24398)63 (link) were purchased from Addgene (Cambridge, MA 02139, USA). Myc-Msr1 was constructed by inserting Msr1 ORF (amplified from Origene clone MR205384) into the pcDNA3.0-Myc vector. The LR2006-OPY1 CHIKV genes were amplified by PCR and subcloned into pcDNA3.0-Myc. Human Atg16l1, Atg16l1ΔFBD (amino residues 229–242 deleted) and Atg16l1ΔWD40 (amino residues 337-end) amplified by PCR and inserted into pcDNA3.1 (Zeo)-FLAG vector. The primers are listed in Supplementary Table 1.
+ Open protocol
+ Expand
2

Ubiquitin Mutant Transfection in HEK293 and HT22 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK293 (human embryonic kidney) and HT22 (mouse hippocampal neuron) cell lines were obtained from the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). Cells were cultured in Dulbecco's modified eagle medium (DMEM, Gibco) supplemented with 10% fetal bovine serum (FBS, Biological Industries). Both cell lines were cultured at 37 °C in a humidified 5% CO 2 atm.
pcDNA4-Vps34-Flag was purchased from Addgene (#24398). All ubiquitin mutants were made from pRK5-HA-ubiquitin plasmid (Addgene) by mutagenesis. pRK5-HA-Ubiquitin-K0 (no lysine), pRK5-HA-Ubiquitin-K6 (keep lysine at position 6), pRK5-HA-Ubiquitin-K11, pRK5-HA-Ubiquitin-K27, pRK5-HA-Ubiquitin-K29, pRK5-HA-Ubiquitin-K33, pRK5-HA-Ubiquitin-K48, pRK5-HA-Ubiquitin-K63. 24 h before transfection, cells were seeded to obtain a final confluence of 60–70%. Transfections were carried out using Lipofectamine™ 2000 (Thermo Fisher Scientific, #11668019) according to manufacturer's protocols. PcDNA3.1 was used as an expression control. siRNA sequence for UBE2N was: GAACCAGTTCCTGGCATCA (RiboBio silencer, ID#stB000527A).15 (link)
+ Open protocol
+ Expand
3

Vps34 Regulation by Umbelliprenin

Check if the same lab product or an alternative is used in the 5 most similar protocols
Following culture in the 6 cm plates for 24 h, BxPC3 cells were transiently transfected with 4 μg of pCDNA4‐Vps34‐Flag (#24398, addgene) plasmid with Lipofectamine 3000 (Invitrogen) and then treated with umbelliprenin or DMSO. The cell lysates containing 500 μg of total protein were mixed with 1 μg of Vps34 antibody and protein A/G beads overnight. The samples were separated by SDS‐PAGE and visualized with enhanced ECL reagents.
+ Open protocol
+ Expand
4

BCRP3 Regulation via shRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
BCRP3 cDNA was amplified from the genomic DNA of BT474 cells using the primers: Fw: 5′ CCGGAATTCACTCCGTAGTGTGCACTTGGT and Rv: 5′ACGCGTCGACTTTTCGTCTCAGGAAACTTTTTAATG. The cDNA was subcloned to the lentiviral vector pLAS5w.Pneo. BCRP3 shRNAs were predicted via BLOCK-iT™ RNAi Designer (https://rnaidesigner.thermofisher.com/), generated by Purigo Biotechnology, Taipei, Taiwan, and cloned to pLKO.1. The shRNA targeting sequences are as follows: shLuc 5′TTACGCTGAGTACTTCGA; shBCRP3#1 5′ATATTGGACGCTGGACCCGC; shBCRP3#2 5′ GACGCTGGACCCGCAGGCCC. Plasmids encoding EGFP-2xFYVE, HA-Beclin 1, and FLAG-Beclin 1 were kindly provided by Guang-Chao Chen (Academia Sinica, Taipei, Taiwan). Plasmids encoding GFP-DFCP1, GFP-LC3, and RFP-p62 were kindly provided by Wei Yuan Yang (Academia Sinica). pcDNA4-VPS34-FLAG was purchased from Addgene, Watertown, MA, USA (#24398). The 4 × SBE-Luc construct was obtained from Rik Derynck (University of California at San Francisco).
+ Open protocol
+ Expand
5

Autophagy Regulation by TcdB Glucosyltransferase

Check if the same lab product or an alternative is used in the 5 most similar protocols
The GFP-LC3 construct was kindly provided by Dr. Li Yu (Tsinghua University). pCMV-myc-ATG7 (24921) and pcDNA4-VPS34-Flag (24398) were purchased from Addgene. pEF-ATG14L, pEF-UVRAG were constructed onto pEF6-BSD-myc/his-B vector. pHis1522-TcdB plasmid was kindly provided by Dr. Hanping Feng (University of Maryland). pHis1522-TcdB-mutant (Y284A &D286N/D288N) was cloned by site mutagenesis. pEF6-BSD-B was used to construct plasmids expressing either glucosyltransferase domain of TcdB or its mutant form (Y284A &D286/288 N). pCMV5-3xFlag-ATG7 was constructed into pCMV5 vector. Primers and other information are listed in supplementary materials.
+ Open protocol
+ Expand
6

Rab5-Mediated Vesicle Dynamics Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
pET-GST-R5BD-hRABEP1 was purchased from Vector Builder. Rab5a-pmCherryC1 was a gift from Christien Merrifield (Addgene plasmid #27679; http://n2t.net/addgene:27679, accessed on 31 May 2019; RRID:Addgene_27679) [41 (link)]. pcDNA4-Vps34-Flag was from Qing Zhong (Addgene plasmid #24398; http://n2t.net/addgene:24398, accessed on 12 November 2018; RRID:Addgene_24398) [42 (link)]. mCherry-Rab5CA(Q79L) was from Sergio Grinstein (Addgene plasmid #35138; http://n2t.net/addgene:35138, accessed on 26 April 2018; RRID:Addgene_35138) [43 (link)]. TagRFP-T-EEA1 was from Silvia Corvera (Addgene plasmid #42635; http://n2t.net/addgene:42635, accessed on 9 November 2017; RRID:Addgene_42635) [44 (link)]. pTag-BFP-C-h-Rab5a-c-Myc was from James Johnson (Addgene plasmid #79801; http://n2t.net/addgene:79801, accessed on 9 November 2017; RRID:Addgene_79801) [45 (link)]. RFP-Rab5 140 and 180 mutants were generated with primers (5′-GCAGCAGCTGTTGACTTCCAGG-3′ and 5′-ATTTGCTAAGTCAGCTTTGTTTCCTGAC-3′) and (5′-GCAGCGCTGCCAAAGAATGAAC-3′ and 5′-AGCTATTGCCATAAATATTTCATTTACATTCATTG-3′), respectively, using a KOD-plus mutagenesis kit (Toyobo, Osaka, Japan).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!