H1299

Manufactured by Cobioer Biosciences

Sourced in China

The H1299 is a cell line derived from a non-small cell lung carcinoma. It is commonly used in cancer research and drug development studies.

Automatically generated - may contain errors

Lab products found in correlation

Rpmi 1640 medium, by Corning (13 mentions) H1975, by Cobioer Biosciences (10 mentions) H1299, by Corning (5 mentions) H1975, by Corning (5 mentions) H1650, by Cobioer Biosciences (5 mentions) Spc a1, by Cobioer Biosciences (5 mentions) Cc 3170, by Lonza (4 mentions) Begm media, by Lonza (4 mentions) Hek293t, by American Type Culture Collection (4 mentions) Beas 2b, by Cobioer Biosciences (3 mentions) Hek293t, by Corning (3 mentions) Dmem medium, by Corning (3 mentions) Rpmi 1640 medium, by Thermo Fisher Scientific (3 mentions) Fetal bovine serum (fbs), by Thermo Fisher Scientific (3 mentions) Hcc827, by Cobioer Biosciences (2 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions) Lipofectamine 3000 reagent, by Thermo Fisher Scientific (2 mentions) Hek293t cell line, by American Type Culture Collection (2 mentions) Pcdna, by GenePharma (1 mentions) Mir 382 5p inhibitor, by GenePharma (1 mentions)

21 protocols using h1299

Transfection of SNHG14, miR-382-5p, and SPIN1 in Lung Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Two human non-small cell lung cancer cells (H1299, catalog #CBP30016L, and A549, catalog #CBP60084) and human pulmonary bronchial epithelium cell BEAS-2B (catalog #CBP60577) were purchased from Cobioer (Nanjing, China). All cells were cultivated in RPMI‑1640 medium (Thermo Fisher Scientific) containing 10% fetal bovine serum (FBS; Thermo Fisher Scientific) and 1% penicillin/streptomycin (Solarbio) in 5% CO₂ incubator at 37°C.
Small interfering RNA (siRNA) against SNHG14 (si-SNHG14, GeneBank accession No. NR_146177; 5ʹ-GCACAAUAUCUUUGAACUA-3ʹ) and its negative control (si-NC), miR-382-5p mimics (miR-382-5p) and its negative control (miR-NC), miR-382-5p antagonist (miR-382-5p inhibitor) and its matched control (inhibitor-NC) were synthesized in GenePharma (Shanghai, China). The sequences of SPIN1 were cloned and inserted into pcDNA (GenePharma) to construct SPIN1 overexpression plasmid (pcDNA-SPIN1). The transfection was performed using Lip2000 Transfection Reagent (Solarbio).

Chen X., Song P., Yao Y, & Yang Y. (2020). Long Non-Coding RNA SNHG14 Regulates SPIN1 Expression to Accelerate Tumor Progression in Non-Small Cell Lung Cancer by Sponging miR-382-5p. Cancer Management and Research, 12, 9113-9123.

+ Open protocol

+ Expand

Culturing Lung Cancer Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

The BEAS-2B cell line was purchased from the Cell Bank of Kunming Institute of Zoology and cultured in BEGM media (Lonza, CC-3170). Lung cancer cell lines, including A549, HCC827, H1299, and H1975, were purchased from Cobioer, China, with STR documents, and were cultured in RPMI-1640 medium (Corning) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin.

Jiang X., Chen M., Du J., Bi H., Guo X., Yang C., He X, & Jin Z. (2022). LncRNA-AC068228.1 Is a Novel Prognostic Biomarker That Promotes Malignant Phenotypes in Lung Adenocarcinoma. Frontiers in Oncology, 12, 856655.

+ Open protocol

+ Expand

Genetic Manipulation of PAQR4 in Lung Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Independent shRNAs targeting PAQR4 were constructed using a pLKO.1 vector. The two independent PAQR4 targeting sequences are: shRNA#1, 5'-GCAGGCTCCGTGCTCTATCAC-3'; shRNA#2, 5'-CGTCTTGCTCTGAGAGTTCAA-3'. The pNFE2L2 (NRF2)-ENTER (Gene ID: NM_006164) and pKEAP1-ENTER (Gene ID: NM_203500) plasmids were purchased from Vigene Biosciences Inc., and were sub-cloned into pCDNA3.1. Nrf2 was N-terminal tagged with 6×Myc, and Keap1 was N-terminal tagged with 3×HA. The full length cDNA of PAQR4 (Gene ID: NM_152341.5) was synthesized by Shanghai Generay Biotech, and sub-cloned into pCDH-MSCV-E2F-eGFP lentiviral vector or pCDNA3.1 vector with a 3×Flag at the C-terminus. The lentiviruses were generated according to the manufacturer's protocol, stable cell lines were generated by lenti-viral infection. The BEAS-2B cell line was a gift from Dr. Hongbin Ji at SIBS, CAS, China. HEK-293T was obtained from ATCC. A549, H1299, H1975, H1650 were purchased from Cobioer, China with STR document, BEAS-2B, A549, H1650, H1975, H358, GLC-82 and SPC-A1 cells were cultured in RPMI1640 medium (Corning) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin. H1299 and HEK-293T cells were cultured in DMEM medium (Corning).

Xu P., Jiang L., Yang Y., Wu M., Liu B., Shi Y., Shen Q., Jiang X., He Y., Cheng D., Xiong Q., Yang Z., Duan L., Lin J., Zhao S., Shi P., Yang C, & Chen Y. (2020). PAQR4 promotes chemoresistance in non-small cell lung cancer through inhibiting Nrf2 protein degradation. Theranostics, 10(8), 3767-3778.

+ Open protocol

+ Expand

Cell Line Culturing for Lung Cancer Research

Check if the same lab product or an alternative is used in the 5 most similar protocols

The BEAS-2B cell line was purchased from the Cell Bank of Kunming Institute of Zoology, and cultured in BEGM media (Lonza, CC-3170). Lung cancer cell lines, including A549, H1299 and H1650, were purchased from Cobioer, China with STR documents, and were cultured in RPMI-1640 medium (Corning) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin.

Chen X., Guo J., Ren W., Zhou F., Niu X, & Jiang X. (2022). LncRNA-AL035458.2/hsa-miR-181a-5p Axis-Mediated High Expression of NCAPG2 Correlates With Tumor Immune Infiltration and Non-Small Cell Lung Cancer Progression. Frontiers in Oncology, 12, 910437.

+ Open protocol

+ Expand

Culturing Lung Cancer Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

BEAS-2B cell line was purchased from Cell Bank of Kunming Institute of Zoology and cultured in BEGM media (Lonza, Basel, Switzerland; CC-3170). Lung cancer cell lines, including A549, H1299, and SPC-A1, were purchased from Cobioer (Nanjing, China) with short tandem repeat (STR) documents, and were cultured in RPMI-1640 medium (Corning, Manassas, VA, USA) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin.

Chen X., Zhou F., Ren W., Guo J., Huang X., Pu J., Niu X, & Jiang X. (2022). LncRNA-AC02278.4 Is a Novel Prognostic Biomarker That Promotes Tumor Growth and Metastasis in Lung Adenocarcinoma. Frontiers in Oncology, 12, 860961.

+ Open protocol

+ Expand

Lung Cancer Cell Line Transfection

Check if the same lab product or an alternative is used in the 5 most similar protocols

The BEAS-2B cell line was purchased from the Cell Bank of Kunming Institute of Zoology and cultured in BEGM media (CC-3170; Lonza, Basel, Switzerland). Lung cancer cell lines, including A549, H1299, H358, HCC827, SPC-A1, H1650, and H1975, were purchased from Cobioer (Nanjing, China), with STR document, and were cultured in RPMI-1640 medium (Corning, Corning, NY, United States) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin. The normal control (NC), miR-125b-5p mimics, and miR-125b-5p inhibitors were purchased from RiboBio (Guangzhou, China). Cells were transfected with the indicated miRNA mimics or NC using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, United States) and then collected for various experiments.

Tang L., Yuan Y., Zhai H., Wang J., Zhang D., Liang H., Shi Y., Duan L, & Jiang X. (2022). MicroRNA-125b-5p Correlates With Prognosis and Lung Adenocarcinoma Progression. Frontiers in Molecular Biosciences, 8, 788690.

+ Open protocol

+ Expand

Cell Line Culture and qRT-PCR Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cell culture, RNA isolation, and real-time polymerase chain reaction (PCR) assay were performed as published (Shi et al., 2019 (link)). The BEAS-2B cell line was purchased from the cell bank of Kunming Institute of Zoology and cultured in BEGM media (Lonza, CC-3170). HEK-293T was obtained from ATCC. Lung cancer cell lines, including A549, H1299, and H1975, were purchased from Cobioer (China) with STR documents; A549, H1299, and H1975 cells were all cultured in RPMI 1640 medium (Corning) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin. HEK-293T cells were cultured in a Dulbecco modified eagle medium (Corning). The detail information of primer used in this study are as follows: NCAPG-F: GAGGCTGCTGTCGATTAAGGA, NCAPG-R: AACTGTCTTATCATCCATCGTGC, TYMSOS-F: ATGACGCCCGCCTCGGGGGCC, TYMSOS-R: TCAGGAAGGACGACCGCACGGGCACC, FOXM1-F: CGTCGGCCACTGATTCTCAAA, FOXM1-R: GGCAGGGGATCTCTTAGGTTC, miRNA-214-3p-F TTTTTACTACTATGGCGGGTGATAAAACGTGTA, miRNA-214-3p-R: GCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC, ACTIN-F: CTTCGCGGGCGACGAT, and ACTIN-R: CCATAGGAATCCTTCTGACC. The expression quantification was obtained with the 2^−ΔΔCt method.

Yuan Y., Jiang X., Tang L., Wang J., Zhang D., Cho W.C, & Duan L. (2022). FOXM1/lncRNA TYMSOS/miR-214-3p–Mediated High Expression of NCAPG Correlates With Poor Prognosis and Cell Proliferation in Non–Small Cell Lung Carcinoma. Frontiers in Molecular Biosciences, 8, 785767.

+ Open protocol

+ Expand

Lentivirus-Mediated Gene Manipulation in Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

Independent shRNAs against different genes targeting different regions were constructed using a pLKO.1 vector. The 3XFlag C-terminal tagged forms of different overexpression genes were synthesized and cloned into a pCDH-MSCV-E2F-eGFP lenti-viral vector. All of the constructs were verified by sequencing, detailed cloning information can be provided upon request. The lenti-viruses were generated according to the manufacturer’s protocol. Briefly, supernatants containing different lenti-viruses generated from HEK-293T cells were collected 48 and 72 h post-transfection. HEK-293T was purchased from ATCC, BEAS-2B was kindly provided by Dr. Hongbin Ji at SIBS, CAS. H1975, A549, NCI-H838, H1299. and NCI-H1650 were purchased from Cobioer, China with STR document, GLC-82, SPC-A1 were gifts from Dr. Yunchao Huang, and A549-DDP was a gift from Dr. Shiyong Sun at Emory University, Atlanta, USA. All cells were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin then incubated in a humidified atmosphere with 5% CO₂ at 37 °C. Cisplatin was purchased from Sigma (Cat#p4394, USA).

Shi Y., Fan S., Wu M., Zuo Z., Li X., Jiang L., Shen Q., Xu P., Zeng L., Zhou Y., Huang Y., Yang Z., Zhou J., Gao J., Zhou H., Xu S., Ji H., Shi P., Wu D.D., Yang C, & Chen Y. (2019). YTHDF1 links hypoxia adaptation and non-small cell lung cancer progression. Nature Communications, 10, 4892.

+ Open protocol

+ Expand

Lentiviral Transduction of H1299 and H1975 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

H1299 and H1975 cells were purchased from COBIOER BIOSCIENCES (Nanjing, Jiangsu, China). They were cultured in RPMI-1640 medium supplemented with 10% FBS at 37 ˚C, 5% CO₂. The lentivirus expressing empty lenti-vector alone and HSD17B6 were purchased from HanBio (Shanghai, China). The cells were infected with lentivirus supplemented with 5 μg/ml polybrene for 24 h, then selected with puromycin (2 μg/ml) for 14 days. The miR-31-5p mimic, miR-31-5p inhibitor, scramble sequence (negative control, NC), and the riboFECT CP transfection kit were supplied by Ribobio (Guangzhou, Guangdong, China). Transfection was performed according to the manufacturer’s instruction.

Tian T., Hong F., Wang Z., Hu J., Chen N., Lv L, & Yi Q. (2021). HSD17B6 downregulation predicts poor prognosis and drives tumor progression via activating Akt signaling pathway in lung adenocarcinoma. Cell Death Discovery, 7, 341.

+ Open protocol

+ Expand

Establishment and Validation of HMMR Knockdown in Lung Cancer Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

The human bronchial epithelial cell line (BEAS2B) and the LUAD cell lines were purchased from the Cell Bank of Kunming Institute of Zoology and cultured in bronchial epithelial cell growth medium (BEGM) (CC-3170; Lonza, Basel, Switzerland). The HEK-293T cell line was obtained from the American Type Culture Collection (ATCC). The lung cancer cell lines A549, H1299, and H1975 were purchased from Cobioer (Nanjing, China) with short tandem repeat (STR) document. A549, H1299, and H1975 cells were all cultured in RPMI 1640 medium (Corning, Corning, NY, USA) supplemented with 10% fetal bovine serum (cat. no. 10099141C; Gibco, Waltham, MA, USA) and 1% penicillin/streptomycin. HEK-293T cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Corning). The short hairpin RNA (shRNA) for HMMR was constructed using pLKO.1 vector. The shRNA for the HMMR primer sequences are as follows: HMMR shRNA#1: AAACAGCTGGAAGATGAAGAAGGAA; HMMR shRNA#2: CAGCTGGAAGATGAAGAAGGAAGAA.

Jiang X., Tang L., Yuan Y., Wang J., Zhang D., Qian K., Cho W.C, & Duan L. (2022). NcRNA-Mediated High Expression of HMMR as a Prognostic Biomarker Correlated With Cell Proliferation and Cell Migration in Lung Adenocarcinoma. Frontiers in Oncology, 12, 846536.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!