Quantitative 7900ht real time pcr apparatus
The Quantitative 7900HT real-time PCR apparatus is a laboratory instrument designed for quantitative real-time polymerase chain reaction (qPCR) analysis. It provides precise detection and quantification of nucleic acid sequences.
3 protocols using quantitative 7900ht real time pcr apparatus
Quantitative Real-Time PCR Analysis of Gene Expression
RNA Extraction and qRT-PCR Analysis
rp-5′_ CGAGCTGCTTCCCTGTTCTTCATTAGACG _3′.
rp-5′_CCTTTTTCACAAGGCCATTTCTGTGTG_3′.
The results were normalized to the cellular house-keeping gene.
rp-5′_GTGTTGGCGTACAGGTCTTTGC_3′.
qRT-PCR Analysis of CREB Expression
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!