RNA was extracted from the cells using the SV Total RNA isolation System (Promega Corp.), according to the manufacturer's instructions. The purified RNA samples were subjected to reverse transcription using GoScript (Promega Corp.), monitored by quantitative 7900HT real-time PCR apparatus (Applied Biosystems by Life Technologies Corp., Carlsbad, CA, USA) utilizing the GoTaq Real-Time PCR reagents (Promega Corp.) and the specific primers: CREB: fp- 5′-CCCAGCACTTCCTACACAGCCTGC-3′, rp5′-CGAGCTGCTTCCUGTTCTT CATTAGACG-3′, HIF-1: fp5′-GGGATTAACTCAGTTGAACTAACTGG-3′, rp5′-CCTTTTTCACAAGGCCATTTCTGTGTG- 3′, HIF-2: fp5′-ACAAGGTGTCAG GCATGGCAAGC-3′, rp5′-CGTTCACCTCACAGTCATATCTGG-3′. The results were normalized to the cellular house-keeping gene GAPDH: fp5′-CCATCTTCCAGGA GCGAGATCC-3′, rp5′-GCAAATGAGCCCCAGCTTCTCC-3′.
Quantitative 7900ht real time pcr apparatus
Manufactured by Thermo Fisher Scientific
Sourced in United States
The Quantitative 7900HT real-time PCR apparatus is a laboratory instrument designed for quantitative real-time polymerase chain reaction (qPCR) analysis. It provides precise detection and quantification of nucleic acid sequences.
Automatically generated - may contain errors
3 protocols using quantitative 7900ht real time pcr apparatus
1
Quantitative Real-Time PCR Analysis of Gene Expression
2
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from the cells using the NucleoSpin® RNA (Macherey-Nagel, Bethlehem, PA, USA), according to the manufacturer’s instructions. The purified RNA samples were subjected to reverse transcription using GoScript (Promega-Corp, Madison, WI, USA), monitored by quantitative 7900HT real-time PCR apparatus (Applied Biosystems, Foster City, CA, United States) utilizing the GoTaq Real-Time PCR reagents (Promega-Corp, Madison, WI, USA) and the following specific primers:
CREB: fp-5′_CCCAGCACTTCCTACACAGCCTGC_3′,
rp-5′_ CGAGCTGCTTCCCTGTTCTTCATTAGACG _3′.
HIF-1: fp-5′_GGGATTAACTCAGTTTGAACTAACTGG_3′,
rp-5′_CCTTTTTCACAAGGCCATTTCTGTGTG_3′.
The results were normalized to the cellular house-keeping gene.
β-actin: fp-5′_CCTTCCTGGGCATGGAGTCC_3′,
rp-5′_GTGTTGGCGTACAGGTCTTTGC_3′.
rp-5′_ CGAGCTGCTTCCCTGTTCTTCATTAGACG _3′.
rp-5′_CCTTTTTCACAAGGCCATTTCTGTGTG_3′.
The results were normalized to the cellular house-keeping gene.
rp-5′_GTGTTGGCGTACAGGTCTTTGC_3′.
3
qRT-PCR Analysis of CREB Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from the cells using the SV Total RNA Isolation System (Promega), according to the manufacturer's instructions. The purified RNA samples were subjected to reverse transcription using GoScript (Promega), monitored by quantitative 7900HT real-time PCR apparatus (Applied Biosystems) utilizing the GoTaq Real-Time PCR reagents (Promega) and the specific primers: CREB: fp- 5′_CCCAGCACTTCCTACACAGCCTGC, rp5′_CGAGCTGCTTCCUGTTCTTCATTAGACG. The results were normalized to the cellular house-keeping gene GAPDH: fp-5′ CCATCTTCCAGGAGCGAGATCC, rp-5′_GCAAATGAGCCCCAGCTTCTCC.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!