Anti cyclin t1

Manufactured by Santa Cruz Biotechnology

Sourced in Morocco, United States

Anti-cyclin T1 is a laboratory product used in molecular biology research. It functions as an antibody that specifically binds to the cyclin T1 protein, which is a subunit of the positive transcription elongation factor b (P-TEFb) complex. The Anti-cyclin T1 antibody can be used to detect and study the expression and localization of cyclin T1 in various experimental systems.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

Cyclin T1 (7 citations)

7 protocols using anti cyclin t1

Characterization of KSHV Latent Gene Regulation

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

SLK (NIH AIDS Reagent Program) and 293T (ATCC) cells were maintained in DMEM medium supplemented with 10% FBS, and penicillin/streptomycin (P/S). BCBL-1 (NIH AIDS Reagent Program) was cultured in RPMI medium with 10% FBS and P/S. iSLK cells carrying BAC16 mutants were grown in DMEM medium with 10% FBS, P/S, 1 μg/ml puromycin, 250 μg/ml G418 and 1 mg/ml hygromycin. The origin of iSLK cell line was previously described [55 (link)]. The following antibodies were used in ChIPs and immunoblots: anti-histone H3 (Abcam ab1791), anti-H3K27me3 (Active Motif #39155), anti-H3K4me3 (Active Motif #39159), anti-EZH2 (Active Motif #39875), anti-SUZ12 (Active Motif #39357), anti-RING1B (Abcam ab3832), anti-BMI1 (Abcam ab14389), LANA (Advanced Biotechnologies #13-210-100). Anti-SPT5 and anti-CyclinT1 antibodies were purchased from Santa Cruz Biotechnology.

Toth Z., Papp B., Brulois K., Choi Y.J., Gao S.J, & Jung J.U. (2016). LANA-Mediated Recruitment of Host Polycomb Repressive Complexes onto the KSHV Genome during De Novo Infection. PLoS Pathogens, 12(9), e1005878.

+ Open protocol

+ Expand

Chromatin Immunoprecipitation Analysis of Androgen Receptor Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols

ChIP analysis was as previously described (25 (link)). Antibodies used were anti- AR (Santa Cruz, Cat. sc-816), anti-pAR-S81 (EMD Millipore, Cat. 07–1375), anti-pRNA Pol II Ser2 (Abcam, Cat., ab5095), anti-pRNA Pol II Ser5 (Abcam, Cat. ab5131), anti-CDK9 (Santa Cruz, Cat. sc-8338), anti-cyclin T1 (Santa Cruz, Cat. sc-10750), anti-BRD4 (Bethyl, Cat. A301-985A); anti-p300 (Santa Cruz, Cat. sc-585), anti-H3K27Ac (Abcam, Cat. ab4729), anti-PP1α (combined Santa Cruz sc-6104 and sc-6105). Primers for ChIP were: PSA-enhancer: Forward, 5΄-GCCTGGATCTGAGAGAGATATCATC-3΄; Reverse, 5΄-ACACCTTTTTTTTTCTGGATTGTTG-3΄; PSA-promoter: Forward, 5΄-TCCTGAGTGCTGGTGTCTTAG-3΄; Reverse, 5΄-CAGGATGAAACAGAAACAGGG-3΄; KLK2-Enhancer: Forward, 5΄-GCCTTTGCTCAGAAGACACA-3΄; Reverse, 5΄-ACAAGAGTGGAAGGCTCTGG -3΄; KLK2-Promoter: Forward, 5΄-CCTGTTGCTGTTCATCCTGA-3΄; Reverse, 5΄-CCTATGGATCATGGAGATGTGA-3΄.

Liu X., Gao Y., Ye H., Gerrin S., Ma F., Wu Y., Zhang T., Russo J., Cai C., Yuan X., Liu J., Chen S, & Balk S.P. (2017). Positive feedback loop mediated by protein phosphatase 1α mobilization of P-TEFb and basal CDK1 drives androgen receptor in prostate cancer. Nucleic Acids Research, 45(7), 3738-3751.

+ Open protocol

+ Expand

Western Blot Antibody Panel for Protein Expression

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Western blot was performed as described [58] (link), [59] (link). The primary antibodies used in this study were: anti-Npac (Catalog No. 14833-1-AP, Proteintech), anti-NP60 (Catalog No. sc-390601, Santa Cruz, Dallas, TX), anti-β-actin (Catalog No. sc-81178, Santa Cruz), anti-Oct4 (Catalog No. sc-8628, Santa Cruz), anti-Nanog (Catalog No. sc-33760, Santa Cruz), anti-Sox2 (Catalog No. sc-99000, Santa Cruz), anti-p-ERK (Catalog No. 4370, Cell Signaling Technology, Danvers, MA), anti-ERK (Catalog No. 137F5, Cell Signaling Technology), anti-histone H3K36me3 (Catalog No. ab9050, Abcam), anti-Pol II (Catalog No. sc-899, Santa Cruz), anti-RNA polymerase II CTD repeat YSPTSPS (phospho S2) (Catalog No. ab5095, Abcam), anti-RNA polymerase II CTD repeat YSPTSPS (phospho S5) (Catalog No. ab140509, Abcam), anti-Cyclin T1 (Catalog No. sc-10750, Santa Cruz), anti-Cdk9 (Catalog No. sc-484, Santa Cruz), anti-mouse IgG (Catalog No. sc-2025, Santa Cruz), anti-goat IgG (Catalog No. sc-2028, Santa Cruz), and anti-rabbit IgG (Catalog No. sc-2027, Santa Cruz).

Yu S., Li J., Ji G., Ng Z.L., Siew J., Lo W.N., Ye Y., Chew Y.Y., Long Y.C., Zhang W., Guccione E., Loh Y.H., Jiang Z.H., Yang H, & Wu Q. (2021). Npac Is A Co-factor of Histone H3K36me3 and Regulates Transcriptional Elongation in Mouse Embryonic Stem Cells. Genomics, Proteomics & Bioinformatics, 20(1), 110-128.

+ Open protocol

+ Expand

Preparation and Analysis of HEK293 Nuclear Extracts

Check if the same lab product or an alternative is used in the 5 most similar protocols

HEK293 nuclear extracts were prepared as described previously^{35 (link)}. For immunoprecipitations, extracts were incubated overnight with 3 μg of the desired antibody pre-bound to protein G-sepharose (Pierce). In some case protein extracts were treated with RNaseA (20 μg ml⁻¹). Immunocomplexes were eluted in 2× Laemmli buffer and resolved in an 8% acrylamide gel. For western blots the following antibodies were used according to manufacturer instructions: anti-NOP58 (Bethyl A302-718A); anti-fibrillarin (Cell Signaling C13C3); anti-DKC1 (Gene Tex GTX109000); anti-Flag (Sigma); anti-DDX21 (Novus Biologicals NB100-1781); anti-LARP7 (a gift from D. H. Price); anti-CDK9 (Santa Cruz Biotechnology sc-484); anti-cyclinT1 (Santa Cruz Biotechnology sc-10750); and anti-HEXIM1 (Bethyl A303-113A). All antibodies have been previously validated unless otherwise specified.

Calo E., Flynn R.A., Martin L., Spitale R.C., Chang H.Y, & Wysocka J. (2014). RNA helicase DDX21 coordinates transcription and ribosomal RNA processing. Nature, 518(7538), 249-253.

+ Open protocol

+ Expand

Immunofluorescence Labeling of Cyclin T1 and Fibrillarin in HeLa Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Hela cell explants were fixed with 4% paraformaldehyde in PBS for 20 min at room temperature, washed twice with PBS, permeabilized for 20 min using 0.3% Triton X-100/PBS, and blocked for 30 min in blocking buffer (10% normal goat serum and 2% bovine serum albumin/PBS). Hela cell explants were incubated with anti-cyclin T1 (1∶200; Santa Cruz Technology, Santa Cruz, CA, USA) and anti-fibrillarin (1∶200; Abcam plc) antibodies, diluted in blocking buffer at 4°C overnight, and incubated for 1 h at room temperature with Alexa Fluor 568- and Alexa Fluor 647-conjugated secondary antibodies (Invitrogen). Fluorescence microscopic images were captured and processed using a Leica TCS SP5 confocal spectral microscope imaging system (Leica Microsystems GmbH, Heidelberger, Germany).

Hong J.B., Chou F.J., Ku A.T., Fan H.H., Lee T.L., Huang Y.H., Yang T.L., Su I.C., Yu I.S., Lin S.W., Chien C.L., Ho H.N, & Chen Y.T. (2014). A Nucleolus-Predominant piggyBac Transposase, NP-mPB, Mediates Elevated Transposition Efficiency in Mammalian Cells. PLoS ONE, 9(2), e89396.

+ Open protocol

+ Expand

Molecular Tools for SIRT7 Research

Check if the same lab product or an alternative is used in the 5 most similar protocols

Plasmids encoding hSIRT7, sh-hSIRT7, Flag-hSIRT7 (1 (link)), Flag/HA-SIRT7 and clonal lines that stably express Flag/HA-SIRT7 (13 ) have been described. SIRT7 truncation mutants were generated by PCR and cloned into pCMV-Flag vector. Oligonucleotides used for plasmid construction and mutagenesis are listed in Supplementary Table S1. Expression vectors encoding HA-CDK9 and Flag-RPB1 were from Addgene. Antibodies against UBF, PAF53, RPA116 and SIRT7 have been described (13 ,17 (link),18 (link)). The following commercial antibodies were used: anti-acetyl lysine (Cell Signaling Technology, 9441), anti-actin (Abcam, ab8227), anti-CDK9 (Santa Cruz, sc-484 (C20)), anti-CHD4/Mi2 (Santa Cruz, sc-55606), anti-cyclin T1 (Santa Cruz, sc-10750), anti-DDX21 (Santa Cruz, sc-376953), anti-Flag (Sigma, F3165), anti-HEXIM1 (Bethyl Laboratories, A303-113A), anti-hnRNPK/J (Santa Cruz, sc-32307), anti-hnRNPU (Santa Cruz, sc-32315), anti-nucleolin (Santa Cruz, sc-13057), anti-nucleophosmin/B23 (Santa Cruz, sc-53175), anti-p53 (Abcam, ab31333), anti-Pol II (Santa Cruz, sc-56767 and sc-899 (N20)), anti-pSer2-Pol II (Active Motif, 6108), anti-pSer5-Pol II (Abcam, ab5408) and anti-tubulin (Sigma, clone B-5-1-2, T6074). anti-Flag M2 agarose was from Sigma (F1804). Secondary antibodies were from Dianova (111-035-144 and 115-035-062).

Blank M.F., Chen S., Poetz F., Schnölzer M., Voit R, & Grummt I. (2017). SIRT7-dependent deacetylation of CDK9 activates RNA polymerase II transcription. Nucleic Acids Research, 45(5), 2675-2686.

+ Open protocol

+ Expand

ChIP Assay for Transcription Factors

Check if the same lab product or an alternative is used in the 5 most similar protocols

ChIP assays were performed using the Magna ChIP A Kit (Millipore) according to the manufacture’s protocol. One µg of pre-immune rabbit IgG, anti-MLL (MO435), anti-Cyclin T1 (Santa Cruz Biotechnology), or PAX5 (Santa Cruz Biotechnology) antibody was utilized for each ChIP reaction. Precipitated DNA was analyzed using ViiA 7 Real-Time PCR System (Applied Biosystems). Primers used for ChIP-PCR assay are: CDKN1B Promoter (-50 bp to +74 bp relative to TSS): forward, ccaatggatctcctcctctg, reverse, aaaacaccccgaaaagacg; CDKN1B coding region (+1441 bp to +1597 bp relative to TSS): forward, atttcccctgcgcttagatt, reverse, atcaacccaccgagctgtt.

Liu H., Westergard T.D., Cashen A., Piwnica-Worms D.R., Kunkle L., Vij R., Pham C.G., DiPersio J., Cheng E.H, & Hsieh J.J. (2014). Proteasome Inhibitors Evoke Latent Tumor Suppression Programs in Pro-B MLL Leukemias Through MLL-AF4. Cancer cell, 25(4), 530-542.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!