Sequencher 4, by Gene Codes - Product details

1

Mitochondrial DNA Analysis of Golden Eagles

Check if the same lab product or an alternative is used in the 5 most similar protocols

The sample of western golden eagles was also assessed using mitochondrial DNA (mtDNA) sequencing of the D-loop region (also known as the control region). A ~415bp fragment of the D-loop region was amplified using the primers GOEA_CR1L and GOEA_CR595H [17 (link)]. PCR products were prepared for sequencing using ExoSAPit according to the manufacturer’s protocol (USB; Affymetrix, Santa Clara, CA USA). Sequencing was performed using a quarter reaction of the BigDye^® Terminator v3.1 Cycle Sequencing Kit. Sequencing products were cleaned using the BigDye^® Xterminator^™ Purification Kit according to the manufacturer’s protocol (Applied Biosystems, Inc.). Sequences were run on a 3130xl Genetic Analyzer (Applied Biosystems, Inc.) and analyzed using Sequencher 4.7 (Gene Codes Corporation, Ann Arbor, MI USA). Sequences were aligned by eye in Sequencher 4.7 (Gene Codes Corporation), and the number of haplotypes was determined using the filter redundant taxa option in MacClade 4.08 [38 ]. Golden eagle haplotypes from other studies in North America [9 (link),17 (link)] were downloaded from Genbank (www.ncbi.nlm.nih.gov/genbank/).

Craig E.H., Adams J.R., Waits L.P., Fuller M.R, & Whittington D.M. (2016). Nuclear and Mitochondrial DNA Analyses of Golden Eagles (Aquila chrysaetos canadensis) from Three Areas in Western North America; Initial Results and Conservation Implications. PLoS ONE, 11(10), e0164248.

+ Open protocol

+ Expand

2

Construction of Δ1D2A-GLuc/SGLuc Chimeras

Check if the same lab product or an alternative is used in the 5 most similar protocols

Example 19

For the construction of Δ1D2A-GLuc/SGLuc chimeras, a nucleotide sequence encoding the Δ1D2A-SGLuc sequence was synthesized by Genescript in the pUC57 kan vector. PCR amplification was performed using OneTaq 2× Master Mix with Standard Buffer (New England Biolabs) and primers AscI-Kzk-2A-F (SEQ ID NO: 185) and Gluc-R-NotI (SEQ ID NO: 186) per manufacturer's instructions. Insertion into the pTarget vector (Promega) followed manufacturer's instructions for T/A cloning. Confirmation of insertion was performed by sequencing with primers T7 (SEQ ID NO: 179) and Seq-R (SEQ ID NO: 180) and analysis of sequencing data was analyzed by Sequencher 4.8 program (Genecodes).

To construct the Δ1D2A-Gluc chimera the pTarget Δ1D2A-SGLuc construct was used as a template for site directed mutagenesis using the GENEART Site-Directed Mutagenesis System (Invitrogen) as per manufacturer's instructions with primers Gluc8990-MF-2 (SEQ ID NO: 197) and Gluc8990-MR-2 (SEQ ID NO: 198). Confirmation of mutation was performed by sequencing with primers T7 (SEQ ID NO: 179) and Seq-R (SEQ ID NO: 180) and analysis of sequencing data was analyzed by Sequencher 4.8 program (Genecodes).

US10858634B2. Vaccines and pharmaceutical compositions against foot-and-mouth disease virus (2020-12-08). The Government of the United States of America, as represented by the Secretary of Homeland Security [US]. Inventors: Michael Puckette [US], Max V. Rasmussen [US].

+ Open protocol

+ Expand

3

Construction of Δ1D2A-GLuc/SGLuc Chimeras

Check if the same lab product or an alternative is used in the 5 most similar protocols

Example 19

For the construction of Δ1D2A-GLuc/SGLuc chimeras, a nucleotide sequence encoding the Δ1D2A-SGLuc sequence was synthesized by Genescript in the pUC57 kan vector. PCR amplification was performed using OneTaq 2× Master Mix with Standard Buffer (New England Biolabs) and primers AscI-Kzk-2A-F (SEQ ID NO: 185) and Gluc-R-NotI (SEQ ID NO: 186) per manufacturer's instructions. Insertion into the pTarget vector (Promega) followed manufacturer's instructions for T/A cloning. Confirmation of insertion was performed by sequencing with primers T7 (SEQ ID NO: 179) and Seq-R (SEQ ID NO: 180) and analysis of sequencing data was analyzed by Sequencher 4.8 program (Genecodes).

To construct the Δ1D2A-Gluc chimera the pTarget Δ1D2A-SGLuc construct was used as a template for site directed mutagenesis using the GENEART Site-Directed Mutagenesis System (Invitrogen) as per manufacturer's instructions with primers Gluc8990-MF-2 (SEQ ID NO: 197) and Gluc8990-MR-2 (SEQ ID NO: 198). Confirmation of mutation was performed by sequencing with primers T7 (SEQ ID NO: 179) and Seq-R (SEQ ID NO: 180) and analysis of sequencing data was analyzed by Sequencher 4.8 program (Genecodes).

US10858633B2. Method for producing foot-and-mouth disease virus (FMDV) viral proteins utilizing a modified FMDV 3C protease (2020-12-08). The Government of the United States of America, as represented by the Secretary of Homeland Security [US]. Inventors: Michael Puckette [US], Max V. Rasmussen [US].

+ Open protocol

+ Expand

4

Constructing Δ1D2A-GLuc/SGLuc Chimeras

Check if the same lab product or an alternative is used in the 5 most similar protocols

Example 19

For the construction of Δ1D2A-GLuc/SGLuc chimeras, a nucleotide sequence encoding the Δ1D2A-SGLuc sequence was synthesized by Genescript in the pUC57 kan vector. PCR amplification was performed using OneTaq 2× Master Mix with Standard Buffer (New England Biolabs) and primers Ascl-Kzk-2A-F (SEQ ID NO: 185) and Gluc-R-NotI (SEQ ID NO: 186) per manufacturer's instructions. Insertion into the pTarget vector (Promega) followed manufacturer's instructions for T/A cloning. Confirmation of insertion was performed by sequencing with primers T7 (SEQ ID NO: 179) and Seq-R (SEQ ID NO:180) and analysis of sequencing data was analyzed by Sequencher 4.8 program (Genecodes).

To construct the Δ1D2A-Gluc chimera the pTarget Δ1D2A-SGLuc construct was used as a template for site directed mutagenesis using the GENEART Site-Directed Mutagenesis System (Invitrogen) as per manufacturer's instructions with primers Gluc8990-MF-2 (SEQ ID NO: 197) and Gluc8990-MR-2 (SEQ ID NO: 198). Confirmation of mutation was performed by sequencing with primers T7 (SEQ ID NO: 179) and Seq-R (SEQ ID NO: 180) and analysis of sequencing data was analyzed by Sequencher 4.8 program (Genecodes).

US10385319B2. Modified foot-and-mouth disease virus 3C proteases, compositions and methods thereof (2019-08-20). The United States of America, as represented by the Secretary of Homeland Security [US]. Inventors: Michael Puckette [US], Max V. Rasmussen [US].

+ Open protocol

+ Expand

5

Construction of Δ1D2A-GLuc/SGLuc Chimeras

Check if the same lab product or an alternative is used in the 5 most similar protocols

Example 19

For the construction of Δ1D2A-GLuc/SGLuc chimeras, a nucleotide sequence encoding the Δ1D2A-SGLuc sequence was synthesized by Genescript in the pUC57 kan vector. PCR amplification was performed using OneTaq 2× Master Mix with Standard Buffer (New England Biolabs) and primers AscI-Kzk-2A-F (SEQ ID NO: 185) and Gluc-R-NotI (SEQ ID NO: 186) per manufacturer's instructions. Insertion into the pTarget vector (Promega) followed manufacturer's instructions for T/A cloning. Confirmation of insertion was performed by sequencing with primers T7 (SEQ ID NO: 179) and Seq-R (SEQ ID NO: 180) and analysis of sequencing data was analyzed by Sequencher 4.8 program (Genecodes).

To construct the Δ1D2A-Gluc chimera the pTarget Δ1D2A-SGLuc construct was used as a template for site directed mutagenesis using the GENEART Site-Directed Mutagenesis System (Invitrogen) as per manufacturer's instructions with primers Gluc8990-MF-2 (SEQ ID NO: 197) and Gluc8990-MR-2 (SEQ ID NO: 198). Confirmation of mutation was performed by sequencing with primers T7 (SEQ ID NO: 179) and Seq-R (SEQ ID NO: 180) and analysis of sequencing data was analyzed by Sequencher 4.8 program (Genecodes).

US10865389B2. DNA vaccines against foot-and-mouth disease virus (2020-12-15). The Government of the United States of America, as represented by the Secretary of Homeland Security [US]. Inventors: Michael Puckette [US], Max V. Rasmussen [US].

+ Open protocol

+ Expand

6

Validating ABCA7 Mutations via Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

All ABCA7 mutations identified in our cohort were validated by sequence analysis. PCR primers were designed to amplify and sequence the genomic regions flanking the mutations. Primer sequences are provided in table e-1 at Neurology.org/ng. PCR products were purified using the Agencourt AMPure system (Beckman Coulter, Brea, CA) and then sequenced in both directions using a Big Dye Terminator v3.1 Cycle Sequencing kit (Applied Biosystems). Sequencing reactions were purified using Agencourt CleanSEQ (Beckman Coulter) and run on an ABI3730xl Genetic Analyzer (Applied Biosystems). Sequence analysis was performed using Sequencher 4.8 software (Gene Codes Corporation, Ann Arbor, MI).

Allen M., Lincoln S.J., Corda M., Watzlawik J.O., Carrasquillo M.M., Reddy J.S., Burgess J.D., Nguyen T., Malphrus K., Petersen R.C., Graff-Radford N.R., Dickson D.W, & Ertekin-Taner N. (2017). ABCA7 loss-of-function variants, expression, and neurologic disease risk. Neurology: Genetics, 3(1), e126.

+ Open protocol

+ Expand

7

Amplicon Sequencing and Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

All amplicons were analysed by electrophoresis in 1 % SeaKem agarose gels (Thermo Fisher Scientific), subsequently excised and purified with a QIAquick Gel Extraction kit (Qiagen) following the manufacturer's instructions. Cycle sequencing of each amplicon was performed with the same consensus primers used for RT-PCR, using a Big Dye Terminator 3.1 Cycle Sequencing Ready Reaction kit (Applied Biosystems). Additionally, primers homologous to internal regions were employed in order to obtain complete sequences of each amplified cDNA (Table 1). The M13 primer (TGTAAAACGACGGCCAGT) was used during sequencing for the amplicon generated by VP4F 1–9 and VP4R 341–321 primers, in order to obtain sequence that is close to the 5′ end. Cycle sequencing products were purified using a carboxyl bead purification method (Mijatovic-Rustempasic et al., 2012 ). Automated separation and base-calling of cycle sequencing products were performed using an ABI3130xl sequencer (Applied Biosystems). Sequence chromatogram files were edited and sequence contigs were assembled using Sequencher 4.8 software (Gene Codes Corporation).

Mijatovic-Rustempasic S., Roy S., Teel E.N., Weinberg G.A., Payne D.C., Parashar U.D, & Bowen M.D. (2015). Full genome characterization of the first G3P[24] rotavirus strain detected in humans provides evidence of interspecies reassortment and mutational saturation in the VP7 gene. The Journal of general virology, 97(2), 389-402.

+ Open protocol

+ Expand

8

Genotyping of ABCA7 Loss-of-Function Variants

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genotyping of ABCA7 pLOF mutations examined in our prior study was performed as previously described^{11 (link)} using Custom TaqMan SNP assays (Applied Biosystems, Foster City, CA) for 5 of the variants. Genotypes were analyzed on ABI Prism 7900 Detection System using SDS version 2.2.2 software (Applied Biosystems). For p.E709fs, the presence of the 7bp deletion was identified by generation of fluorescently labeled PCR products and assessed using the ABI3730xl Genetic Analyzer (Applied Biosystems) and GeneMapper Software 5.0 (Applied Biosystems). All ABCA7 pLOF mutations identified were validated by sequence analysis as described previously^{11 (link)} with the exception of rs20053873 (c.5570+5G>C), in which confirmation used PCR primer sequences for exon 41 (forward sequence: ctggggcctcactgagcacc; reverse sequence: gggcctggtccgcgtgtggg). PCR products and sequencing reactions were purified and ran using the Agencourt AMPure system (Beckman Coulter, Brea, CA) and BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) and Agencourt CleanSEQ (Beckman Coulter) and ABI3730xl Genetic Analyzer (Applied Biosystems), respectively. Sequence analysis was performed using Sequencher 4.8 software (Gene Codes Corporation, Ann Arbor, MI).

Campbell A.S., Ho C.C., Atık M., Allen M., Lincoln S., Malphrus K., Nguyen T., Oatman S.R., Corda M., Conway O., Strickland S., Petersen R.C., Dickson D.W., Graff-Radford N.R, & Ertekin-Taner N. (2022). Clinical Deep Phenotyping of ABCA7 Mutation Carriers. Neurology: Genetics, 8(2), e655.

+ Open protocol

+ Expand

9

Norovirus Genotyping by Partial Capsid Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

PCR products were separated on a 2% agarose gel and products of expected size (330 bp for GI, 344 bp for GII) were excised and purified by QIAquick gel extraction kit (QIAGEN, Valencia, CA) as per manufacturer’s instructions. Purified products were cycle-sequenced in both directions using Big Dye-based sequencing method on an ABI Prism^® 3130xl Genetic Analyzer by Macrogen (Seoul, Korea). Raw sequences were edited and assembled subsequently using Sequencher 4.8 software (Gene Codes, Ann Arbor, MI). The phylogenetic trees were based on partial capsid sequences (region C) having amplicon size of 264 and 252 bp for GI and GII, respectively. The phylogenetic relationship was inferred by the Maximum Likelihood method with Jukes–Cantor nucleotide substitution models, and 100 bootstrap replicates, using MEGA5.05 software [Tamura et al., 2011 (link)].

Alam A., Quresh S.A., Vinjé J, & Zaidi A. (2015). Genetic Characterization of Norovirus Strains in Hospitalized Children From Pakistan. Journal of medical virology, 88(2), 216-223.

+ Open protocol

+ Expand

10

Rare Variant Validation by Sanger Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

For sequence validation, specific primers were designed surrounding each rare variant detected by Exome sequencing (Supplementary Table 2). In addition, all exonic regions of TYROBP were amplified by PCR using specific primers (sequences available upon request). Prior to sequencing, PCR products were purified using the AMPure system (Beckman Coulter Genomics, Brea, CA, USA). Sequence reactions were purified with CleanSEQ (Beckman Coulter Genomics, Brea, CA, USA) and then Sanger sequenced on an ABI3730xl Genetic Analyzer. Sequences were analyzed using Sequencher 4.8 software (Gene Codes Corporation, Ann Arbor, MI, USA).

Pottier C., Ravenscroft T.A., Brown P.H., Finch N.A., Baker M., Parsons M., Asmann Y.W., Ren Y., Christopher E., Levitch D., van Blitterswijk M., Cruchaga C., Campion D., Nicolas G., Richard A.C., Guerreiro R., Bras J.T., Zuchner S., Gonzalez M.A., Bu G., Younkin S., Knopman D.S., Josephs K.A., Parisi J.E., Petersen R.C., Ertekin-Taner N., Graff-Radford N.R., Boeve B.F., Dickson D.W, & Rademakers R. (2016). TYROBP genetic variants in early-onset Alzheimer’s disease. Neurobiology of aging, 48, 222.e9-222.e15.

+ Open protocol

+ Expand

Sequencher 4

Lab products found in correlation

Close spelling variants of this product

203 protocols using sequencher 4

Mitochondrial DNA Analysis of Golden Eagles

Construction of Δ1D2A-GLuc/SGLuc Chimeras

Construction of Δ1D2A-GLuc/SGLuc Chimeras

Constructing Δ1D2A-GLuc/SGLuc Chimeras

Construction of Δ1D2A-GLuc/SGLuc Chimeras

Validating ABCA7 Mutations via Sequencing

Amplicon Sequencing and Analysis

Genotyping of ABCA7 Loss-of-Function Variants

Norovirus Genotyping by Partial Capsid Sequencing

Rare Variant Validation by Sanger Sequencing

About PubCompare

Ready to get started?