RNA extractions and cDNA syntheses were carried out as described above, mRNA levels of β-Actin, NANOG and Oct4 genes were assessed in samples isolated from P5 (early P) and P7 (late P). QRT-PCR reactions were carried out using SYBR® Premix Ex Taq™ II (Tli RNase H Plus) (Cat # RR820) in a Rotor-Gene 6000 Real-time PCR Detection System (Corbett, UK), according to the manufacturer’s instructions. PCR amplification has conducted with the following settings: hold at 95°C for 5 minutes, followed by 40 cycles: denaturation for 15 seconds at 95°C, annealing for 35 seconds at 60°C, and extension for 15 seconds at 72°C. Relative gene expression was calculated with the 2–ΔΔCt method, the amount of target, normalized to an endogenous reference and relative to a calibrator, where ΔCt = Ct target gene–Ct endogenous reference and ΔΔCt = ΔCt sample– ΔCt calibrator. All tests have performed in triplicate [29 (link)]. Primer sequences for target genes were[30 (link)]: OCT4 forward primer: 5´-CCATGCATTCAAACTGAGGTG-3´; OCT4 reverse primer: 5´-CCTTTGTGTTCCCAATTCCTTC-3´; NANOG forward primer: 5´-AGTCCCAAAGGCAAACAACCCACTTC-3´; NANOG reverse primer: 5´-TGCTGGAGGCTGAGGTATTTCTGTCTC -3´, β-Actin forward primer: 5´-CCTTCCTTCCTGGGCATG-3´; β-Actin reverse primer: 5´- TCCTGTCGGCAATGCCAG -3´ [31 (link)].
Rotor gene 6000 real time pcr detection system
Manufactured by Qiagen
Sourced in United Kingdom, Germany
The Rotor-Gene 6000 Real-time PCR Detection System is a laboratory equipment designed for real-time polymerase chain reaction (PCR) analysis. It is capable of detecting and quantifying nucleic acid sequences in real-time. The system utilizes a rotor-based design and features multiple channels for simultaneous detection of different fluorescent dyes.
Automatically generated - may contain errors
Lab products found in correlation
Sybr premix ex taq 2 tli rnase h plus, by Qiagen (2 mentions)
Platinum superfi 2 dna polymerase, by Thermo Fisher Scientific (1 mentions)
Thermal cycler, by Avantor (1 mentions)
Cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Rnx plus kit, by CinnaGen (1 mentions)
Sybr green rox fast mastermix, by Qiagen (1 mentions)
Rt2 profiler pcr array, by Qiagen (1 mentions)
Platinum taq polymerase, by Thermo Fisher Scientific (1 mentions)
6 protocols using rotor gene 6000 real time pcr detection system
1
Quantitative Gene Expression Analysis
2
Long-range PCR Amplification of cf-mtDNA in CSF
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Long-range PCR amplification of cf-mtDNA in CSF was performed using Platinum™ SuperFi II DNA polymerase (12368010, Thermo Scientific). CSF samples were either added directly to the PCR reaction or solubilised with 1:1 v:v of DNA/RNA/protein solubilisation reagent 100ST (DCQ100ST, DirectQuant). The PCR reaction was performed in a 50 μl volume containing either 4 μl of CSF or 2 μl of solubilised CSF and a final concentration of 150 nM of each forward and reverse primers (forward: 5′—TGAACATACAAAACCCACCCCATTCCTC—3′, reverse: 5′—GTGGCTTTGGAGTTGCAGTTGATGTGTG—3′) from Basu et al.24 This primer pair amplifies an mtDNA sequence of 10840 bp from bases 5420 to 16259 of the human mtDNA reference sequence NC_01290.1 when mtDNA does not contain deletions in the major arc. PCR was performed following a two-step protocol with the following conditions: 95 °C for 3 min; 35 repeats of the cycle 95 °C for 30 s and 67 °C for 7 min, followed by 67 °C for 5 min using the Rotor-Gene 6000 Real-Time PCR detection system (Corbett Research, Qiagen GmbH). Amplified long-range PCR products were analysed by electrophoresis on 0.8% agarose gels, purified using GeneJET Gel Extraction DNA micro Kit (K0832, Thermo Scientific) and re-amplified following the same PCR protocol. Sanger DNA sequencing of the re-amplified PCR products was performed using Stab Vida services (825-182 Caparica, Portugal).
3
Evaluating Stem Cell Impact on Ovarian Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After 5 days of co‐culturing, Transwells™ containing stem cells were discarded. Total RNA of SKOV3 and hSFCs in lower well were extracted using RNX‐Plus kit (CinnaGen, cat# RN7713C) in accordance to its protocol. The complementary DNA (cDNA) was created from extracted RNA using cDNA Synthesis Kit (Fermentas, cat# K1621) about 20 µl for each sample and was performed in a Thermal Cycler (PeQLab). Primers used for qRT‐PCR. As an internal control, it utilized b‐actin (housekeeping gene). mRNA levels of β‐Actin, P53, P21, cyclinD1 and B1 genes were measured in SKOV3 and human fibroblast cells with SYBR® Premix Ex Taq™ II (Tli RNase H Plus) (Ashburner et al., 2000 ) as qRT‐PCR master mix in a Rotor‐Gene 6000 Real‐time PCR Detection System (Corbett, UK), matching to the manufacturer's instructions. The temperature setting of qRT‐PCR amplification. Relative gene expression was calculated by 2–ΔΔCt method (Livak & Schmittgen, 2001 ) and was compared with the effects of hAFMSCs on SKOV3 with hSFCs. Furthermore, t test was done for statistical analysis.
4
Real-time PCR Analysis of Esophageal Cancer Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
Real-time PCR with Rotor-Gene 6000 real-time PCR Detection System (Corbett, UK) was applied to determine the effect of Hesa-A on the P53, P16, P21, cyclin D1, and cyclin B1 genes expression in esophageal carcinoma. First-strand cDNA was amplified for various mRNA, using P53, P16, P21, cyclin D1, and cyclin B1.Table 1 shows the primers used in this study. β-Actin was used for housekeeping genes.
+ Expand
Real-time PCR with Rotor-Gene 6000 real-time PCR Detection System (Corbett, UK) was applied to determine the effect of Hesa-A on the P53, P16, P21, cyclin D1, and cyclin B1 genes expression in esophageal carcinoma. First-strand cDNA was amplified for various mRNA, using P53, P16, P21, cyclin D1, and cyclin B1.
5
Endothelial Cell Biology Gene Expression Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time PCR was carried out by using a Rotor-Gene 6000 Real-Time PCR detection system (Qiagen, Germany). Gene expression was examined using the Human Endothelial Cell Biology RT2 Profiler™ PCR Array (cat # 330231, Qiagen, Germany). Expression of 84 different genes, involved in permeability and vascular tone, angiogenesis, endothelial cell activation, and endothelial cell injury, was targeted for detection by real-time PCR. The RT2Profiler™ PCR Array contains built-in primers for 84 tested and 5 housekeeping genes and positive control elements to determine the efficiency of the reverse transcription reaction, performance of the PCR reaction, and detection of genomic DNA contamination. The PCR mixture for 100 reactions contained 1150 μL of SYBR Green ROX FAST Mastermix (Qiagen, Germany), 102 μL cDNA template, and 1048 μL RNase-free water. The PCR reaction mix was added to the wells of the PCR plate in equal amounts (20 μL), and then the real-time PCR cycling program was run. The thermal cycling program recommended by plates manufacturer for Rotor-Gene 6000 was as follows: 10 min at 95°C followed by 40 cycles: denaturation at 95°C for 15 s, with 30 s annealing and elongation at 60°C, followed by melting curve analysis. The software version 2.1.0 (Qiagen, Germany) was used for analysis.
6
Optimized qPCR Protocol for Reliable Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The qPCR reactions were conducted in triplicate in holding Strip Tubes (0.1 mL) (Qiagen, Hilden, Germany), using a Rotor gene 6000 Real-Time PCR detection system (Qiagen, Hilden, Germany). A qPCR cocktail-mix was prepared with 2.5 mM MgCl 2 , 2mM dNTP (each), 0.3 U of Platinum Taq polymerase (Invitrogen), 10 picomoles of each primer pair, and 20X EvaGreen fluorescent dye Biotium®, and 3.2 ng/µL of cDNA in a final volume of 15 µL. Amplification conditions were: 95°C for 5 min; 40 cycles of 95°C (60 s), 61°C (30 s) and 72°C (5s), acquiring the fluorescence at 79°C (1 s); finally a dissociation step from 65°C to 95°C (1°C/s) was done. For each candidate reference gene, the melt curve and gel picture were analyzed to verify the specificity of the amplified products and to confirm that at a single PCR product had been amplified. Amplification efficiencies were used for gene stability analyses of the potential set of reference genes (Table 1).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!