Pwzlblast gfp

Retroviral plasmids encodingHRasG12V, HRasG12V/E37G, HA-STK38 PIF, HA-STK38 PIF/kd, and shLUC have been reported [34 (link), 38 (link), 62 (link)]. To generate the pSuper.retro.puro_shSTK38-2 vector expressing shRNAs against human STK38, the following oligonucleotide pairs were inserted into pSuper.retro.puro (Oligoengine) using BglII and HindIII: 5′-GATCCCCGTCGGCCATAAACAGCTATTCAAGAGATAGCTGTTTATGGCCGACGTTTTTGGAAA-3′ and 5′- AGCTTTTCCAAAAACGTCGGCCATAAACAGCTATCTCTTGAATAGCTGTTTATGGCCGACGGG-3′ targeting the 3′UTR of STK38. For shRNA rescue experiments, HA-tagged STK38 wild-type and kinase-dead (K118A) cDNAs were subcloned from modified pcDNA3_HA into modified pWZLblast using PmeI and XhoI. Modified pcDNA_HA was generated by inserting the following oligonucleotide pairs into pcDNA3 (Invitrogen) using HindIII and BamHI: 5′-AGCTTACGCGTGTTTAAACGGTACCATGGCCTACCCCTACGACGTGCCCGACTACGCCTCCCTCG-3′ and 5′-GATCCGAGGGAGGCGTAGTCGGGCACGTCGTAGGGGTAGGCCATGGTACCGTT TAAACACGCGTA-3′. Modified pWZLblast was generated by inserting the following oligonucleotide pairs into pWZLblast GFP (12269, Addgene) using BamHI and SalI: 5′-GATCCACGCGTGTTTAAACGTTAACGAATTCTACGTACTCGAGG -3′ and 5′-TCGACCTCGAGTACGTAGAATTCGTTAACGTTTAAACACGCGTG -3′. All constructs were confirmed by sequence analysis. Further details on constructs are available upon request.

Human breast cancer cell lines SKBR3, MDA-MB-468, MCF-7, and MDA-MB were purchased from ATCC. Cells were cultured in petri dishes with Dulbecco’s Modified Eagle Medium (DMEM; HyClone, Logan, UT, USA) supplemented with 10% fetal bovine serum (HyClone, South Logan, UT, USA), and 1% penicillin/streptomycin (Gibco, Co Dublin, Ireland) in an atmosphere of 5% CO₂ at 37 °C. Cells were passaged every 2–3 days using 0.25% Trypsin (Gibco, Co Dublin, Ireland). For plasmid transfection, pWZL Blast Twist ER, pWZL Blast Snail ER, and empty vector pWZL Blast GFP were obtained from Addgene (Cambridge, MA, USA). These plasmids were transfected into cells using Lipofectamine 3000 Reagent (Thermo Fisher, Waltham, MA, USA). The validation of transfection was conducted using quantitative RT-PCR analysis.