Log In Sign up
The largest database of trusted experimental protocols

Kod hot start master mix

Manufactured by Merck Group
Visit Supplier
Sourced in Germany

KOD Hot Start Master Mix is a high-fidelity DNA polymerase enzyme designed for accurate and efficient DNA amplification. It provides robust performance in a variety of PCR applications.

Automatically generated - may contain errors

Lab products found in correlation

Qiaquick pcr purification kit, by Qiagen (6 mentions) Qiaquick gel extraction kit, by Qiagen (4 mentions) T4 dna ligase, by New England Biolabs (4 mentions) Ecori hf, by New England Biolabs (2 mentions) Bamhi hf, by New England Biolabs (2 mentions) Scai hf, by New England Biolabs (2 mentions) Sphi hf, by New England Biolabs (2 mentions) Rsii instrument, by Pacific Biosciences (2 mentions) High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions) Direct zol rna miniprep kit, by Zymo Research (2 mentions) Miniprep kit, by Qiagen (2 mentions) Pe sumo cryaa, by Addgene (2 mentions) High efficiency dh5α, by New England Biolabs (2 mentions) Pegfp hsp27 wt fl, by Addgene (2 mentions) Kod xtreme hot start dna polymerase, by Merck Group (2 mentions) Qiaamp dna mini kit, by Qiagen (2 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions) Trizol, by Thermo Fisher Scientific (2 mentions) Dneasy blood tissue extraction kit, by Qiagen (1 mentions) Hotstartaq dna polymerase, by Qiagen (1 mentions)

22 protocols using kod hot start master mix

1

CFTR Genetic Editing Quantification

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
For HEKs, genomic DNA (gDNA) was collected 72 h post-transfection. For CFBE cells and primary airway cells, gDNA was collected directly from snapwell filters after short circuit measurements were taken. Genomic DNA (gDNA) extraction was performed using the DNeasy Blood & Tissue Extraction Kit (QIAGEN, catalog no. 69504). Following extraction, editing was assessed by PCR amplification of the relevant CFTR exon (Table S1). For HEK and CFBE experiments PCR was performed with KOD hot start master mix (Millipore Sigma). For primary cells, PCR was performed using HotStarTaq DNA polymerase (QIAGEN, catalog no. 203203). For both cell lines and primary cells PCR products were purified, Sanger sequenced, and editing rate at the target site and bystander sites were quantified using EditR.34 (link)
Joynt A.T., Kavanagh E.W., Newby G.A., Mitchell S., Eastman A.C., Paul K.C., Bowling A.D., Osorio D.L., Merlo C.A., Patel S.U., Raraigh K.S., Liu D.R., Sharma N, & Cutting G.R. (2023). Protospacer modification improves base editing of a canonical splice site variant and recovery of CFTR function in human airway epithelial cells. Molecular Therapy. Nucleic Acids, 33, 335-350.
+ Open protocol
+ Expand
2

Quantifying Spliced RNA Isoforms

Check if the same lab product or an alternative is used in the 5 most similar protocols
cDNA was used as a template for RT-PCR performed with KOD hot start master mix (Millipore Sigma) and a forward primer bearing a 5′ 6FAM tag (Table S1). PCR products were separated on an Applied Biosystems 3730 DNA Analyzer capillary electrophoresis system at the Johns Hopkins Genetics Resources Core Facility (GRCF). GeneScan 500 Rox was used as an internal size standard. To calculate relative RNA isoform quantity, the area under the curve (AUC) for each isoform was compared with the total AUC for that sample. For assessment of missplicing after bystander editing (Figure S3) amplification from exon 16 to exon 19 allowed for determination of the relative abundance of normally spliced and exon 18 skipped transcript. For primary cells, amplification from exon 11 to exon 13 allowed for quantification of the relative abundance of transcript from the F508del allele (F508del) and transcript from the c.2988+1G>A allele (non-F508del) (Figure S6; Table S3).
Joynt A.T., Kavanagh E.W., Newby G.A., Mitchell S., Eastman A.C., Paul K.C., Bowling A.D., Osorio D.L., Merlo C.A., Patel S.U., Raraigh K.S., Liu D.R., Sharma N, & Cutting G.R. (2023). Protospacer modification improves base editing of a canonical splice site variant and recovery of CFTR function in human airway epithelial cells. Molecular Therapy. Nucleic Acids, 33, 335-350.
+ Open protocol
+ Expand
3

Amplification and Purification of Genomic Regions

Check if the same lab product or an alternative is used in the 5 most similar protocols
Flanking primers with a 40 bp overlap were designed to amplify 700 bp up- and downstream of the gene of interest using SnapGene® (version 4.0.3) with the Gibson Assembly tool (Supplementary Table S1). Fragments were amplified using a high-fidelity polymerase mix (KOD Hot Start Master Mix, Millipore) and separated on a 1% agarose gel. Vectors were purified from overnight cultures using a plasmid miniprep kit (ZymoPURE™, ZymoResearch). Vectors were digested using EcoRI-HF and BamHI-HF (New England BioLabs) for 1 h at 37 °C, or PCR-amplified, and purified on agarose gel. Alternatively, vectors can also be amplified by long-range PCR. Final concentrations of amplificated fragments and digested vectors were measured using a microvolume spectrometer (Colibri®).
Cianfanelli F.R., Cunrath O, & Bumann D. (2020). Efficient dual-negative selection for bacterial genome editing. BMC Microbiology, 20, 129.
+ Open protocol
+ Expand
4

Gene Amplification and Vector Preparation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Flanking primers with a 40 bp overlap were designed to amplify 700bp up-and downstream of the gene of interest using SnapGene® (version 4.0.3) with the Gibson Assembly tool (Supplementary Table S1). Fragments were amplified using a high-fidelity polymerase mix (KOD Hot Start Master Mix, Millipore) and purified on a 1% agarose gel. Vectors were purified from overnight cultures using a plasmid miniprep kit (ZymoPURETM, ZymoResearch). Vectors were digested using EcoRI-HF and BamHI-HF (New England BioLabs) for 1h at 37°C, or PCR-amplified, and purified on agarose gel. Final concentrations of amplificated fragments and digested vectors were measured using a microvolume spectrometer (Colibri®).
Cianfanelli F.R., Cunrath O., & Bumann D. (2020). Efficient Dual-Negative Selection for Bacterial Genome Editing.
+ Open protocol
+ Expand
5

Fungal DNA Amplification and Identification

Check if the same lab product or an alternative is used in the 5 most similar protocols
Two zones of fungal DNA were amplified by conventional PCR: ITS1-2 rRNA with the universal primers ITS1 (TCCGTAGGTGAACCTGCGGG) and ITS4 (TCCTCCGCTTATTGATGGC); and the D1/D2 domains of large sub-unit (LSU) ribosomal DNA (rDNA) with the universal primers NL1 (GCATCAATAAGCGGGAGGAAAG) and NL4 (GGTCCGTGTTTCAAGGGG). Reactions were prepared by combining 25 μL of KOD Hot start Master Mix (Sigma Aldrich®), 1.5 μL of each primer (10 μM), 18.5 μL of nuclease free water, and 3.5 μL DNA extract (20 ng/μL). DNA was amplified using the following conditions on a thermocycler: 94°C for 5 min, followed by 35 amplification cycles (94°C for 30 seconds, 55.7°C for ITS1-2 or 58.1°C for D1/D2 for 30 seconds, and 72°C for 60 seconds), with a final incubation of 72°C for 7 min. The PCR product was verified using 1.5% agarose gel electrophoresis and sequenced (Macrogen USA). The sequence of each PCR product was analyzed using Sequencher 5.4.6 Software (Gen Codes Corporation). Subsequently, the Nucleotide BLAST tool (NCBI) was used to align the observed sequence to known reference sequences.
Correa Y., Cabanillas B., Jullian V., Álvarez D., Castillo D., Dufloer C., Bustamante B., Roncal E., Neyra E., Sheen P, & Sauvain M. (2019). Identification and characterization of compounds from Chrysosporium multifidum, a fungus with moderate antimicrobial activity isolated from Hermetia illucens gut microbiota. PLoS ONE, 14(12), e0218837.
+ Open protocol
+ Expand
6

L1PA2-L1PB1 Gene Amplification and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols
cDNA from HARA and LK-2 cells was used as template for PCR amplification, performed using KOD Hot Start Master Mix (Sigma) with the following primers:
Target Forward Reverse
L1PA2-L1PB1TTTGACTCAGAAAGGGAACT GTACGCCAATTTTAATTGTT
Separately, cDNA from LK-2 cells was amplified using nested PCR with the following primers:
Target Forward Reverse
L1PA2-L1PB1 first round TTTGACTCAGAAAGGGAACT AGGTAGTGGGATGCCTCCAG
L1PA2-L1PB1 second round GCAATGCCTCACCCTGCTTC GGTCTTGCACCTCCTTGGTT
The PCR products were Sanger sequenced by Genewiz, Essex, UK, using the same primers.
Kazachenka A., Loong J.H., Attig J., Young G.R., Ganguli P., Devonshire G., Grehan N., Ciccarelli F.D., Fitzgerald R.C, & Kassiotis G. (2023). The transcriptional landscape of endogenous retroelements delineates esophageal adenocarcinoma subtypes. NAR Cancer, 5(3), zcad040.
+ Open protocol
+ Expand
7

Melittin Gene Amplification and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols
The extracted genomic DNA was used as a template for amplified melittin sequencing. This study designed the primers using Geneious version 8.1.8 (forward primer: 5′ GGA ATT CCA TAT GGG AAT TGG AGC AGT TC3′ and reverse primer: 5′GGC GCG GAT CCT TAT TAC TGT TGC CT3′). The melittin gene was synthesized using the KOD Hot Start Master Mix (Merck Millipore, Darmstadt, Germany). The thermal cycling conditions were as follows: one cycle of initial denaturation at 95 °C for 2 min, 35 cycles of denaturation at 95 °C for 20 s, annealing at 55 °C for 10 s, and extension at 70 °C for 10 s. The PCR products were purified using the PureLink® Gel Extraction Kit (Life Technologies, Carlsbad, CA, USA) and sequencing (Macrogen Inc., Seoul, Korea).
Maitip J., Mookhploy W., Khorndork S, & Chantawannakul P. (2021). Comparative Study of Antimicrobial Properties of Bee Venom Extracts and Melittins of Honey Bees. Antibiotics, 10(12), 1503.
+ Open protocol
+ Expand
8

Cloning and sequencing of DNA fragments

Check if the same lab product or an alternative is used in the 5 most similar protocols
Liver total DNA (5 micrograms) was digested with SphI-HF (NEB, Cat. No. R3182L) and ScaI-HF (NEB, Cat. No. R3122L) for one hour. The resulting DNA fragments were resolved on 0.8% agarose gel, and the DNA from the 3.0-4.0 kbp region was excised from the gel and purified using the QIAquick Gel Extraction Kit (Qiagen, Cat. No. 28706). DNA was end-blunted using DNA polymerase I, large (Klenow) fragment (NEB, Cat. No. M0210L), and underwent self-ligation using T4 DNA ligase (NEB, Cat. No. M0202T). Ligation product was purified using the QIAquick PCR Purification Kit (Qiagen, Cat. No. 28106), and subjected to PCR with primers DW888 and DW889 (Supplementary Fig. 12b) using KOD Hot Start Master Mix (EMD Millipore, Cat. No. 71842-4). PCR products were TOPO cloned and sequenced as mentioned above.
Wang D., Li J., Song C.Q., Tran K., Mou H., Wu P.H., Tai P.W., Mendonca C.A., Ren L., Wang B.Y., Su Q., Gessler D.J., Zamore P.D., Xue W, & Gao G. (2018). Diseases caused by different mutations in the two alleles of a gene are treated in mice by Cas-9-induced allelic exchange.: Cas9-mediated allelic exchange repairs compound heterozygous recessive mutations in mice. Nature biotechnology, 36(9), 839-842.
+ Open protocol
+ Expand
9

Sensitive Quantitation of Gene Editing

Check if the same lab product or an alternative is used in the 5 most similar protocols
The neo gene copy number was determined by ddPCR as described above. Normalization to Tfrc gene copy number (two copies per diploid genome) allows for the calculation of neo frequency (i.e. neo copy number / Tfrc copy number). Short amplicons spanning the TyrC or FahPM mutation were generated by PCR using KOD Hot Start Master Mix (EMD Millipore, Cat. No. 71842-4). Amplicons generated from individual mice were labeled by using barcoded PCR primers (Supplementary Fig. 12). PCR products were purified using the QIAquick PCR Purification Kit (Qiagen, Cat. No. 28106). Purified amplicons from multiple mice were pooled, and the mixture was subjected to Single Molecule, Real-Time (SMRT) sequencing using an RSII Instrument (Pacific Biosciences), running the SMRT Analysis v2.3 software packages at the Deep Sequencing Core Facility at University of Massachusetts Medical School. Reads were de-multiplexed and aligned to custom reference sequences representing the Tyr or Fah amplicons using BWA-MEM on the Galaxy web-based platform for genome data analysis30 (link)–32 . “Mutation frequencies” at each locus were reported as the percentage of aligned reads carrying the TyrC allele (G-to-C mutation) or the FahPM allele (G-to-A mutation) among all reads that correctly map to the respective Tyr or Fah references, as assessed on the Integrative Genomes Viewer (IGV, version 2.3.98)33 (link).
Wang D., Li J., Song C.Q., Tran K., Mou H., Wu P.H., Tai P.W., Mendonca C.A., Ren L., Wang B.Y., Su Q., Gessler D.J., Zamore P.D., Xue W, & Gao G. (2018). Diseases caused by different mutations in the two alleles of a gene are treated in mice by Cas-9-induced allelic exchange.: Cas9-mediated allelic exchange repairs compound heterozygous recessive mutations in mice. Nature biotechnology, 36(9), 839-842.
+ Open protocol
+ Expand
10

Sensitive Quantitation of Gene Editing

Check if the same lab product or an alternative is used in the 5 most similar protocols
The neo gene copy number was determined by ddPCR as described above. Normalization to Tfrc gene copy number (two copies per diploid genome) allows for the calculation of neo frequency (i.e. neo copy number / Tfrc copy number). Short amplicons spanning the TyrC or FahPM mutation were generated by PCR using KOD Hot Start Master Mix (EMD Millipore, Cat. No. 71842-4). Amplicons generated from individual mice were labeled by using barcoded PCR primers (Supplementary Fig. 12). PCR products were purified using the QIAquick PCR Purification Kit (Qiagen, Cat. No. 28106). Purified amplicons from multiple mice were pooled, and the mixture was subjected to Single Molecule, Real-Time (SMRT) sequencing using an RSII Instrument (Pacific Biosciences), running the SMRT Analysis v2.3 software packages at the Deep Sequencing Core Facility at University of Massachusetts Medical School. Reads were de-multiplexed and aligned to custom reference sequences representing the Tyr or Fah amplicons using BWA-MEM on the Galaxy web-based platform for genome data analysis30 (link)–32 . “Mutation frequencies” at each locus were reported as the percentage of aligned reads carrying the TyrC allele (G-to-C mutation) or the FahPM allele (G-to-A mutation) among all reads that correctly map to the respective Tyr or Fah references, as assessed on the Integrative Genomes Viewer (IGV, version 2.3.98)33 (link).
Wang D., Li J., Song C.Q., Tran K., Mou H., Wu P.H., Tai P.W., Mendonca C.A., Ren L., Wang B.Y., Su Q., Gessler D.J., Zamore P.D., Xue W, & Gao G. (2018). Diseases caused by different mutations in the two alleles of a gene are treated in mice by Cas-9-induced allelic exchange.: Cas9-mediated allelic exchange repairs compound heterozygous recessive mutations in mice. Nature biotechnology, 36(9), 839-842.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!