Gotaq g2 flexi dna polymerase kit

To validate the identified variants after whole-genome sequencing, exon 24 of the MYH3 (myosin heavy chain 3) gene was amplified using 200 ng of DNA, on a Master Thermal Cycler (Eppendorf) with the GoTaq G2 Flexi DNA polymerase kit (Promega) and with 35 amplification cycles: 94 °C/20 s; 60 °C/30 s; 72 °C/30 s. The primers used were MYH3ex24F 5′-GGCATCCTTCACTCACATCAT-3′ and MYH3ex24R 5′-AGCTGGAGGCTAAGATCAAGG-3′. Then, Sanger sequencing was performed according to standard protocols (Eurofins MWG).

Total RNA was extracted using the RNeasy Mini Kit (QIAGEN), according to manufacturer’s instructions and quantified using NanoPhotometer P330 (Implen). 1 μg of total RNA was retro-transcribed using the SuperScript IV First-Strand Synthesis System (Thermo Fisher Scientific). qPCR was performed in triplicate on 20 ng of cDNA using QuantiFast SYBR Green PCR Kit (Qiagen) and the LightCycler 480 System (Roche). Reactions were performed in 20 μl of final volume in triplicates. Samples were normalized using GAPDH as reference gene. Experiments were repeated three times. Primer sequences were: TSPYL2_for AGGCACTGGAGGATATTCAG; TSPYL2_rev GAAGGGTCTTCGCATCTGGAT; GAPDH_for ACCACAGTCCATGCCATCAC; GAPDH-rev TCCACCACCCTGTTGCTGTA. PCR analyses were performed with the GoTaq G2 Flexi DNA Polymerase kit (Promega) according to manufacturer’s procedure and using the following conditions: 95 °C for 5 minutes, 35 cycles of PCR (95 °C for 30 seconds, 64 °C for 30 seconds, 72 °C for 30 seconds) and 72 °C for 10 minutes. The amplification products were loaded on 2% agarose gels. Primers used were: SRY_for GCATTCATCGTGTGGTCTCG; SRY_rev TTCGCTGCAGAGTACCGAAG; GAPDH primers were the same used for qPCR.

RNA was extracted from sera using the QIAmp viral RNA minikit (Qiagen, Germany) followed by reverse transcription (RT; SuperScript III First-Strand Kit, Invitrogen, Germany) and DNA amplification by nested PCR (both PCRs via GoTaq G2 Flexi DNA Polymerase Kit, Promega, Germany) according to manufacturers' protocols. Specific primers for HCV genotype 1a and 1b can be found in Supplementary Table 3.

PCV-2 genotype was determined by amplifying and sequencing the PCV-2 capsid protein gene (ORF2). This gene was amplified using a previously described procedure [30 (link)] but using a modified version of the reverse primer (5′-CGTATCCAAGGAGGCGTTAC-3′). The PCR was carried out using the GoTaq^® G2 Flexi DNA Polymerase Kit (Promega, Madison, MI, USA) containing 2.5 μL of the extracted 1/100 diluted DNA, 1.25 μL of each primer at 10 pmol/μL, 5 μL of 5 × Green GoTaq^® Flexi Buffer, 2.5 μL of MgCl₂ at 25 mM, 0.15 U GoTaq^® polymerase (5U/μL), 1 μL of dNTP at 5 mM, and up to 25 μL of DEPC-treated water. The amplification parameters were as follows: initial denaturation of 5 min at 94 °C, followed by 35 cycles of 95 °C for 30 s, 53 °C for 30 s, and 72 °C for 40 s, with a final elongation at 72 °C for 7 min. Subsequently, the amplified PCR product was visualized through electrophoreses in a 2% agarose gel.
The PCR amplicon was purified using the NucleoSpin Gel^® and PCR Clean-up kit (Macherey-Nagel, Düren, Germany), according to the manufacturer’s instructions. The quality and quantity of DNA from each sample were analyzed with Biodrop (Biodrop Ltda, Cambridge, UK) and then submitted to Servei de Genòmica i Bioinformàtica of the Universitat Autònoma de Barcelona (Spain) for Sanger DNA sequencing with the ABI PRISM sequencer 3130xl (Applied Biosystem^®, Waltham, MA, USA).

A preparation of mRNA encoding a ZFN targeting the start of the Sprn ORF was purchased from Sigma-Aldrich Corp (CompoZrTM ZFN design). The ZFN target site was 5′-ctgtgacagctgttccgccangggcggccgcggaggcg-3′. ZFN mRNA was injected at 2 ng/μl into 1 cell-fertilized FVB/NJ mouse eggs. Surviving injected eggs were transferred into pseudo-pregnant recipient mice. Tail-DNA analysis of the 29 resulting live pups was performed by PCR using oligonucleotides 5′-gccggccttacgcgtactcttga-3′ and 5′-gcctattcccaagccctgatac-3′, using the Promega GoTaq G2 Flexi DNA polymerase kit. PCR conditions were made of 40 amplifications cycles; 94 °C-30 s, 60 °C-30 s and 72 °C-30 s. The amplified 400 bp long DNA genomic region surrounding the ZFN target site was sequenced to search for putative mutations.
Transgenic founder mice were crossed with FVB/NJ mice to establish transgenic lines. Intercrosses between heterozygous mice were used to derive transgenic knockout lines.

First-strand cDNA was synthesized from 5 to 10 ng of total RNA primed with oligo(dT)20 and random primers (3:1, vol/vol) using Superscript III reverse transcriptase (Invitrogen Life Technologies Inc., Carlsbad, CA) according to the manufacturer’s instructions. One microliter of 2 U/μL RNase H (Invitrogen Life Technologies) was then added and the reaction mix was incubated for 20 min at 37°C to remove RNA from heteroduplexes. Single-strand cDNA thus obtained was stored at -20°C. cDNA samples covering the entire coding regions of caseins were amplified. PCR was performed in an automated thermocycler GeneAmp® PCR System 2,400 (Perkin-Elmer, Norwalk, USA) with GoTaq® G2 Flexi DNA Polymerase Kit (Promega Corporation, USA). Reactions were carried out with 0.2 mL thin-walled PCR tubes with flat cap strips (Thermo Scientific, UK), in 50 μL volumes containing 5X Green or Colorless GoTag® Flexi Buffer, MgCl₂ Solution 25 mM, PCR Nucleotide Mix 10 mM each, GoTag® G2 Flexi DNA Polymerase (5 U/μL), 10 mM each oligonucleotide primer, template DNA and nuclease-free water, up to the final volume. Primer pairs, purchased from Eurofins (Eurofins genomics, Germany), were designed using published Camelus nucleic acid sequence. Sequencing of PCR fragments was performed with primer pairs used for PCR and sequenced from both strands, according to the Sanger method by Eurofins.

In order to assess the number of (GT)n repeats in the HMOX1 promoter region PCR reaction was done using GoTaq^®G2 Flexi DNA Polymerase Kit (Promega, Madison, WI, USA) and the following pair of primers was applied: Forward: 5′-AGA GCC TGC AGC TTC TCA GA-3′, Reverse: 5′-ACA AAG TCT GGC CAT AGG AC-3′, where forward primer was labeled with 6-carboxyfluoresceine (FAM). PCR reaction was conducted under following conditions: 95 °C for 60 s, 37 cycles of 95 °C for 30 s, 58 °C for 15 s, 73 °C for 30 s and final elongation 73 °C for 45 s. DNA fragments analysis was performed by capillary electrophoresis (ABI PRISIM^® 310 Genetic Analyzer, Applied Biosystem, Foster City, CA, USA) with GeneScan^TM 350 ROX^TM dye Size Standard. Fragments sizes were determined with ABI Prism program (Gene Scan Analysis and Genotyper Software, Applied Biosystems, Foster City, CA, USA). In two patients from the SR group and in two patients from IR group, due to technical reasons it was impossible to determine length polymorphism, so data on length polymorphism are available for 56 children.