TRIzol (15596,018, Ambion, USA) was used to isolate total RNAs from the cells, tissues, and exosomes. Tiagen (KG203, Beijing, China) provided the DNA extraction kit for cell genomic DNA extraction. The cDNA Synthesis SuperMix (11120ES60, Yeasen) was used to reverse transcript circRNA and mRNA into cDNA. The miRNA cDNA Synthesis Kit (R601, EnzyArtisan Biotech, China) was used to reverse transcript miRNA into cDNA. The QPCR SYBR Green Mix (11201ES08, Yeasen, China) was used for conducting qPCR. Electrophoresis was performed on 2% agarose gel after PCR. For qRT-PCR, the PCR products were quantified on the MX3000P (Agilent, USA). The primers were synthesized by the EnzyArtisan Biotech (China), and the 2-ΔΔCt method was used for calculation [38 (link)]. The primer sequences are listed in Table S3.
Sybr green qpcr mix
Manufactured by Yeasen
Sourced in China
SYBR Green qPCR mix is a ready-to-use solution for quantitative real-time PCR analysis. It contains SYBR Green I dye, DNA polymerase, dNTPs, and necessary buffers.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (5 mentions)
Abi 7500 system, by Thermo Fisher Scientific (3 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (2 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (2 mentions)
Primescript reverse transcriptase assay, by Takara Bio (2 mentions)
Cdna synthesis supermix, by Yeasen (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Mx3000p, by Agilent Technologies (1 mentions)
Reverse transcription kit, by Yeasen (1 mentions)
Trizol reagent, by CWBIO (1 mentions)
Trizol rna purification kit, by Thermo Fisher Scientific (1 mentions)
Ecl reagent, by Yeasen (1 mentions)
β actin antibody, by Proteintech (1 mentions)
M mlv reverse transcriptase, by Promega (1 mentions)
Rq1 rnase free dnase, by Promega (1 mentions)
Reverse transcription kit, by Takara Bio (1 mentions)
Total rna extraction kit, by Promega (1 mentions)
Primescript rt master mix, by Takara Bio (1 mentions)
Ariamx real time pcr, by Agilent Technologies (1 mentions)
Trizol reagent, by Vazyme (1 mentions)
14 protocols using sybr green qpcr mix
1
Total RNA, DNA, and cDNA Extraction and Quantification Protocol
2
Quantifying Gene Expression Patterns with qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were extracted from fresh culture cells using TRIzol Reagent (CWBIO, Beijing, China), and subsequently were reverse transcribed into cDNA by a Reverse Transcription kit (Yeasen, Shanghai, China). Quantitative real-time PCR (qPCR) was performed with the Eco™ PCRmax system, using a qPCR SYBR Green mix (Yeasen). The primers used in this study were as follows: LINC02605#1 (for basic qPCR), (forward) 5’-GCTGCCTTGTTGGATGGGTGCT-3’, (reverse) 5’-GCATTGCCTGCTTCCGCTCT-3’; LINC02605#2 (for qPCR), (forward) 5’-CATGAACCCTGTGGGCCTTT-3’, (reverse) 5’-GCTGTTCCATCTGGGACCTA-3’; human IFNB1, (forward) 5’-ACTGCCTCAAGGACAGGATG-3’, (reverse) 5’-GGCCTTCAGGTAATGCAGAA-3’; VSV RNA, (forward) 5’-ACGGCGTACTTCCAGATGG-3’, (reverse) 5’-CTCGGTTCAAGATCCAGGT-3’; human GAPDH, (forward) 5’-ACCCACTCCTCCACCTTTGA-3’, (reverse) 5’-CTGTTGCTGTAGCCAAATTCGT-3’, and U6, (forward) 5’-CTCGCTTCGGCAGCACA-3’, (reverse) 5’-AACGCTTCACGAATTTGCGT-3’; human CXCL10, (forward) 5’-GTGGCATTCAAGGAGTACCTC-3’, (reverse) 5’-TGATGGCCTTCGATTCTGGATT-3’; human IFN-stimulated gene (ISG)-15, (forward) 5’-CGCAGATCACCCAGAAGATCG-3’, (reverse) 5’-TTCGTCGCATTTGTCCACCA-3’; human PTEN (for basic PCR), (forward) 5’-CTAGAGGAGACCCAAGGGCT-3’, (reverse) 5’-AAAAAGGGGGCCAAACTCCA-3’; human PTEN (for q-PCR), (forward) 5’-TGGATTCGACTTAGACTTGACCT-3’, (reverse) 5’-GGTGGGTTATGGTCTTCAAAAGG-3’.
3
Comprehensive RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Leibovitz's L-15 cell culture medium (Cat. 11415114), fetal bovine serum (FBS), penicillin-streptomycin (Cat. 15140122), lipofectamine 3000, and TRIzol RNA purification kit (Cat. 12183555) were purchased from ThermoFisher Scientific. First-strand cDNA synthesis kit with genomic DNA digester, ECL reagents, and qPCR SYBR Green Mix were all purchased from Yeasen Biotech. ADAM28 polyclonal antibody (Cat. 22234-1) and β-actin antibody (Cat. 20536-1) were obtained from Proteintech Group. The primers of the indicated target genes for RT-PCR were produced by Invitrogen. Gemcitabine was from TCI, and other chemical reagents are analytical grade and were provided by Aladdin.
4
RNA Extraction and RT-qPCR from Nuclear and Cytoplasmic Fractions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with TRIzol reagent (Thermo Fisher Scientific). The extracted RNA was dissolved in nuclease-free water and then treated with DNase (RQ1 RNase-Free DNase, Promega). Reverse transcription was achieved with M-MLV Reverse Transcriptase (Promega). Real-time qPCR was achieved with qPCR SYBR Green Mix (Yeasen).
For nuclear and cytoplasmic RNA extraction (Hwang et al., 2007 (link)), N2a cells were placed on ice, washed with ice-cold PBS three times, and then collected by spinning at 1000 rpm for 10 min. The resulting cells were resuspended in 200 μL lysis buffer A (pH 8.0, 10 mmol/L Tris, 140 mmol/L NaCl, 1.5 mmol/L MgCl2, 0.5% NP-40, 1 mmol/L DTT, 100 U/mL RNasin), incubated on ice for 5 min, then centrifuged at 1,000 ×g for 3 min. The supernatant was collected for cytoplasmic RNA extraction. The pellets were further washed twice with the lysis buffer A and once with the lysis buffer A complemented with 1% Tween-40 and 0.5% deoxycholic acid. The resulting pellets were resuspended in TRIzol for nuclear extraction.
For nuclear and cytoplasmic RNA extraction (Hwang et al., 2007 (link)), N2a cells were placed on ice, washed with ice-cold PBS three times, and then collected by spinning at 1000 rpm for 10 min. The resulting cells were resuspended in 200 μL lysis buffer A (pH 8.0, 10 mmol/L Tris, 140 mmol/L NaCl, 1.5 mmol/L MgCl2, 0.5% NP-40, 1 mmol/L DTT, 100 U/mL RNasin), incubated on ice for 5 min, then centrifuged at 1,000 ×g for 3 min. The supernatant was collected for cytoplasmic RNA extraction. The pellets were further washed twice with the lysis buffer A and once with the lysis buffer A complemented with 1% Tween-40 and 0.5% deoxycholic acid. The resulting pellets were resuspended in TRIzol for nuclear extraction.
5
Micro DNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A micro genomic DNA extraction kit (DP316; TIANGEN BIOTECH BEIJING, CO., LTD, China) was used to extract genomic DNA (gDNA) from blood according to the manufacturer's protocol. In brief, approximately 20 µL of blood from the tail veins were added to tubes containing 100 µL of lysis buffer and 10 µL of proteinase K (20 mg/mL). The suspension was then digested in a water bath at 56°C. The gDNA was purified and eluted following the manufacturer's protocol.
Quantitative PCR primers were designed to target the human‐specific unique sequence of Alu and β‐actin. Primer sequences are shown in TableS1 . Quantitative real‐time PCR assays were performed by Applied Biosystems ABI 7500 system (Thermo Fisher, Waltham, MA, USA). The reaction mixture was loaded into a PCR 8‐Tube, and qPCR assays were performed in a 20 µL volume containing 10 µL of qPCR SYBR Green mix (Yeasen Biotech, Shanghai, China), 0.4 µL of forward and reverse primers, and 20 ng of template gDNA diluted in water. SYBR Green PCR reaction conditions were as follows: the holding phase was 95°C for 2 min. Cycles were 40 cycles of 95°C for 10 s and 60°C for 34 s.
Quantitative PCR primers were designed to target the human‐specific unique sequence of Alu and β‐actin. Primer sequences are shown in Table
6
Gene Expression Analysis of Aging and Inflammation in HUVECs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mRNA expression of ageing‐related genes p53 and p21, intercellular adhesion molecule 1 (ICAM1) and vascular cell adhesion molecule 1 (VCAM1), and TGFβ1 pathway genes TGFβ1, Smad2, Smad3 and IκBα were analysed by real‐time PCR, respectively. Total RNA of HUVECs was extracted by TRIzol reagent (Invitrogen, Carlsbad, CA, USA); then, cDNAs were synthesized using PrimeScript Reverse Transcriptase assay (Takara, Dalian, China) according to the manufacturer's instructions. Real‐time PCR was performed using SYBR Green qPCR mix (YEASEN, Shanghai, China) on the ABI 7500 System (Applied Biosystems, Foster City, CA, USA). GAPDH levels were used as internal controls, and fold changes were calculated by relative quantification (2−ΔΔCt). The primers applied for real‐time PCR were shown in Table S1 .
7
Quantifying Alzheimer's Markers in Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The hippocampus of the mice treated with AGEs, BSA, and AGEs + LiCl was extracted. Total RNA was extracted using Promega’s total RNA extraction kit following the manufacturer guidelines. The concentration of RNA was determined by measuring the absorbance at 260 nm, and 2 μg of RNA was used for first-strand cDNA synthesis using Takara’s reverse transcription kit. The mixture of cDNA samples and the indicated primers (Table 1 ) was subjected to at least three replicate qPCR amplification using YEASEN’s SYBR Green qPCR mix. Relative gene expression was calculated by comparing the CT value of the gene of interest with the CT value of the internal reference gene GAPDH.
The qPCR primer sequences of the human genes (APP, TAU, GAPDH) required for the experiment were found in the Primer Bank, as shown inTable 1 .
The qPCR primer sequences of the human genes (APP, TAU, GAPDH) required for the experiment were found in the Primer Bank, as shown in
8
Quantifying Gene Expression Changes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mRNA expression levels of p53, p21, vascular cell adhesion molecule 1 (VCAM1), intercellular adhesion molecule (ICAM1) and Smad3 were analyzed via RT-qPCR (primer sequences are listed in Table SI ). Briefly, total RNA was extracted from cells using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.). cDNA was reverse transcribed using PrimeScript™ RT Master Mix (Takara Bio, Inc.) under the following thermocycling conditions: 37°C for 15 min, 85°C for 5 sec. RT-qPCR was performed using SYBR Green qPCR mix (Shanghai Yeasen Biotechnology Co., Ltd.) on an ABI 7500 system (Applied Biosystems; Thermo Fisher Scientific, Inc.). The reaction conditions were conducted as following: Initial denaturation for 10 min at 95°C, followed by 40 cycles of denaturation at 95°C for 15 sec, annealing and elongation at 60°C for 1 min, and final extension at 72°C for 1 min. GAPDH expression was used as internal control, and the expression of target gene was calculated using relative quantification (2−ΔΔCq) method (18 (link)).
9
Quantitative RT-PCR Analysis of Gene Expression in Aortic Aneurysm
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tissue from patients with AAA (n = 5) and healthy controls (n = 5) were extracted using TRIZOL reagent (Vazyme, Nanjing, China). Total RNA was reversely transcribed into cDNA according to the manufacturer's protocol (Vazyme, Nanjing, China). Quantitative RT-PCR was conducted using SYBR Green qPCR Mix (Yeasen, Shanghai, China) in an Agilent Technologies AriaMx Real-Time PCR(G8830A) with the following cycle conditions: 95 ℃ for 5 min, 95 ℃ for 10 s, and 60 ℃ for 30 s, over 40 cycles. GAPDH can be used as an internal reference for gene screening. Primer sequences for RT-qPCR (Table 3 ). The 2−ΔΔCT method was used for statistical analysis [14 (link), 15 (link)]. All data were averaged from three independent experiments.
Primer sequences for RT-qPCR
| Gene name | Sequences (5′ → 3′) |
|---|---|
| GAPDH forward | AAGAAGGTGGTGAAGCAGGC |
| GAPDH reverse | TCCACCACCCAGTTGCTGTA |
| IL6 forward | AAGCCAGAGCTGTGCAGATGAGTA |
| IL6 reverse | TGTCCTGCAGCCACTGGTTC |
| PPARG forward | CACATTACGAAGACATTCCATTCAC |
| PPARG reverse | GGAGATGCAGGCTCCACTTTG |
| FOXO3 forward | GGTGCTAAGCAGGCCTCATCTC |
| FOXO3 reverse | AATGGCGTGGGATTCACAAAG |
| SOD1 forward | AGTGCAGGGCATCATCAATTTC |
| SOD1 reverse | CCATGCAGGCCTTCAGTCAG |
| MAP1LC3B forward | AGTTGGCACAAACGCAGGGTA |
| MAP1LC3B reverse | TTAGGAGTCAGGGACCTTCAGCA |
10
Quantifying BMI1 Expression in MIHA Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from MIHA cells using RNA Extraction Reagent (19201ES60; YEASEN, China). Then, the isolated RNA was reversely transcribed into cDNA using a cDNA Synthesis Kit (11119ES60; YEASEN). Subsequently, qPCR was performed by SYBR Green qPCR Mix (11198ES03; YEASEN) in a real-time PCR system (ABI 7300; ABI, USA). The primer sequences are listed below: BMI1-forward: 5′-AGATCGGGGCGAGACAATG-3′, reverse: 5′-TTTTATTCTGCGGGGCTGGG-3′; GAPDH-forward: 5′-GTCTCCTCTGACTTCAACAGCG-3′, reverse: 5′-ACCACCCTGTTGCTGTAGCCAA-3′. The expression values were normalized to GAPDH using the 2−ΔΔCT method [16 (link)].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!