Pyromark sequencing platform

Allele-specific expression was quantified using Qiagen PyroMark sequencing platform. Amplicons containing SNPs were designed using the PyroMark Assay Design software. cDNAs were synthesized using Invitrogen SuperScript III One-Step RT-PCR System (Invitrogen,#12574-026). Following the PCR reaction, 5 ul of a total of 25 uL of reaction was run on a 3% agarose gel to assess the efficacy of amplification. The samples were then prepared for pyrosequencing according to the standard recommendations for use with the PyroMark Q96 ID sequencer. For Xist, the following primers were used: forward, CAAGAAGAAGGATTGCCTGGATTT; reverse, 5′-biotin-GCGAGGACTTGAAGAGAAGTTCTG; sequencing, CAAACAATCCCTATGTGA. For Atrx, the following primers were used: forward: ATAGCTTCAGATTCTGATGAAACC; reverse: 5′-biotin-ACATCGTTGTCACTGCCACTT; sequencing: taagctcagatgaaaaga. For Rnf12, the following primers were used: forward: 5′-Biotin-TGCAGCCAACAAGTGAAATTCC; reverse: TATCTGCTGTCTCAGGGTCACATG; sequencing: tagaacttccttcaggc. All three amplicons span intron(s), thus permitting discrimination of RNA vs. any contaminating genomic DNA amplification due to size differences. Control reactions lacking reverse transcriptase for each sample were also performed to rule out genomic DNA contamination.