Log In Sign up
The largest database of trusted experimental protocols

Ab15050

Manufactured by Abcam
Visit Supplier

Ab15050 is a primary antibody that recognizes the Myc-tag epitope. It is designed for use in various applications, such as immunoprecipitation, Western blotting, and immunostaining, to detect and analyze Myc-tagged proteins.

Automatically generated - may contain errors

Lab products found in correlation

Gtx100675, by GeneTex (1 mentions) Magnify chip system, by Thermo Fisher Scientific (1 mentions) Ab8895, by Abcam (1 mentions) Ab11852, by Abcam (1 mentions) Ab10805, by Abcam (1 mentions) G 21040, by Thermo Fisher Scientific (1 mentions) Ab4729, by Abcam (1 mentions) F1804, by Merck Group (1 mentions) G 21234, by Thermo Fisher Scientific (1 mentions) Ab37355, by Abcam (1 mentions) Fast sybr green master mix, by Thermo Fisher Scientific (1 mentions) Chip it express enzymatic shearing and chip protocol, by Active Motif (1 mentions) Enzymatic shearing cocktail, by Active Motif (1 mentions) Qiaquick pcr purification kit, by Qiagen (1 mentions) T perk, by Cell Signaling Technology (1 mentions) Xbp1s e9v3e, by Cell Signaling Technology (1 mentions) P perk, by Cell Signaling Technology (1 mentions) Bip c50b12, by Cell Signaling Technology (1 mentions) C ebpβ, by Abcam (1 mentions) A100754, by Sangon (1 mentions)

5 protocols using ab15050

1

ChIP Assay for Histone Modifications

Check if the same lab product or an alternative is used in the 5 most similar protocols
The ChIP assay was performed after cross-linking cells using formaldehyde. DNA was sonicated using an Ultrasonic Processor (Bioruptor UCD-200) at 12 cycles of 30 s with 30 s interval between cycles. Sonicated DNA was then centrifuged at 20,000 × g at 4 °C. Supernatant was used for ChIP assay using MAGnify ChIP system (Invitrogen). Two micrograms of mouse IgG, HDAC1 (Abcam-ab15050), H3ac (active motif 39139), C/EBPβ (Genetex GTX100675) was used per ChIP. Immunoprecipitated DNA was analyzed by qPCR, and Ct values were used to calculate the percentage of input enrichment.
Bastola S., Pavlyukov M.S., Yamashita D., Ghosh S., Cho H., Kagaya N., Zhang Z., Minata M., Lee Y., Sadahiro H., Yamaguchi S., Komarova S., Yang E., Markert J., Nabors L.B., Bhat K., Lee J., Chen Q., Crossman D.K., Shin-Ya K., Nam D.H, & Nakano I. (2020). Glioma-initiating cells at tumor edge gain signals from tumor core cells to promote their malignancy. Nature Communications, 11, 4660.
+ Open protocol
+ Expand
2

Antibody Panel for Epigenetic Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols
The following antibodies were used in this study: anti-H3K4me1 (ab8895, Abcam), anti-H3K27ac (ab4729, Abcam), anti-5-methylcytosine (ab10805, Abcam), anti-GATA1 (ab11852, Abcam), anti-TAL1 (C-4) (sc-393287X, Santa Cruz), anti-CEBP/β (ab15050, Abcam), anti-c-Jun (G-4) (sc-74543X, Santa Cruz), anti-PU.1 (B-9) (sc-390659X, Santa Cruz), and anti-Flag (M2) (F1804, Sigma-Aldrich). Anti-mouse IgG HRP-linked antibodies (G-21040, Invitrogen) and anti-rabbit IgG HRP-linked antibodies (G-21234, Invitrogen).
Li M., Jiang P., Cheng K., Zhang Z., Lan S., Li X., Zhao L., Wang Y., Wang X., Chen J., Ji T., Han B, & Zhang J. (2021). Regulation of MYB by distal enhancer elements in human myeloid leukemia. Cell Death & Disease, 12(2), 223.
+ Open protocol
+ Expand
3

Chromatin Immunoprecipitation Assay Protocol

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Chromatin immunoprecipitation assay was performed as described previously (44 (link)). Briefly, cells were crosslinked with 1% formaldehyde for 10 min at RT and quenched for 5 min by adding 0.125 M glycine. After harvested in SDS lysis buffer and sonication, DNA–protein complexes were immunoprecipitated with Chromatin immunoprecipitation-grade protein G magnetic beads (Cell Signaling Technology) and corresponding antibodies against H4R3me2a (39705, Active Motif), C/EBPβ (ab15050, abcam), or IgG (2729s, Cell Signaling Technology). After IP, DNA samples were analyzed by qPCR and normalized to IgG or inputs. The primers used are listed in Table S4.
Zhu Q., Wang D., Liang F., Tong X., Liang Z., Wang X., Chen Y, & Mo D. (2022). Protein arginine methyltransferase PRMT1 promotes adipogenesis by modulating transcription factors C/EBPβ and PPARγ. The Journal of Biological Chemistry, 298(9), 102309.
+ Open protocol
+ Expand
4

Chromatin Immunoprecipitation of C/EBPβ

Check if the same lab product or an alternative is used in the 5 most similar protocols
BMDCs or T cells activated as described above were cultured with propyzamide or vehicle. After 48 h, cells were prepared according to the ChIP-IT Express Enzymatic Shearing and ChIP protocol (53009, Active Motif). In brief, cells were fixed in 1% formaldehyde, washed in PBS and glycine Stop-Fix solution. Cells were pelleted, and chromatin was sheared using the Enzymatic Shearing Cocktail (Active Motif) for 10 min at 37 °C. Sheared chromatin was immunoprecipitated with 5 μg of anti-C/EBPβ antibody (ab15050, Abcam) or mouse IgG control (ab37355, Abcam) overnight at 4 °C with rotation. The next day, magnetic beads were washed, and cross-links were reversed in 0.1% SDS and 300 mM NaCl TE buffer at 63 °C for 4 h. DNA fragments were purified using the QIAquick PCR Purification Kit (28104, Qiagen). qPCR was performed using the Fast SYBR Green Master Mix (4385612, Thermo Fisher Scientific). The following primer pairs were used: CEBP Il23 site 1 F, CATGACACGGGAACCAGACT; R, AGGGGCAGGGAAGTAATGGA; CEBP Il23 site 2 F, AACTTTTGAGAGCCTGCCGT; R, GTACAGCGATGATGACCCGT; CEBPB Rorc F, CGAAGCTCCCCAGCTAGAAC; R, GGGGTTTAAGCTCTGCTCCA; CEBPB Il12rb1 F, CCTTCAGCCCTGCAGAAGTT; R. GGCCACAAGGACAAAGAGGA; CEBPB Ifng F, GAGAGCCCAAGGAGTCGAA; R, TACCTGATCGAAGGCTCCTC; CEBPB Tnf F, GTGGAGAAAGACGGGGATG; R, ATCTGCTTGTTCATTCATTCATTC; CEBPB Il1b F, TCTCTTTATCTGGGGTGTGAGTT; R, AGCCCTCAGGTAGAGGAACC.
Sanmarco L.M., Chao C.C., Wang Y.C., Kenison J.E., Li Z., Rone J.M., Rejano-Gordillo C.M., Polonio C.M., Gutierrez-Vazquez C., Piester G., Plasencia A., Li L., Giovannoni F., Lee H.G., Akl C.F., Wheeler M.A., Mascanfroni I., Jaronen M., Alsuwailm M., Hewson P., Yeste A., Andersen B.M., Franks D.G., Huang C.J., Ekwudo M., Tjon E.C., Rothhammer V., Takenaka M., de Lima K.A., Linnerbauer M., Guo L., Covacu R., Queva H., Fonseca-Castro P.H., Bladi M.A., Cox L.M., Hodgetts K.J., Hahn M.E., Mildner A., Korzenik J., Hauser R., Snapper S.B, & Quintana F.J. (2022). Identification of environmental factors that promote intestinal inflammation. Nature, 611(7937), 801-809.
+ Open protocol
+ Expand
5

Immunoblotting Analysis of ER Stress Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols
For the IB assay, 1 × 104 LSK cells or 2 × 105 splenocytes were washed once with RPMI with 0.1% phenylmethylsulfonyl fluoride (A100754; Sangon Biotech), and the supernatant was carefully removed by using a 200-μl tip. The cell pellet was lysed in 10 μl of lysis buffer (62.5 mM Tris-HCl, pH 6.8, 2% [wt/vol] SDS, 10% [wt/vol] glycerol, 50 mM dithiothreitol, and 0.01% [wt/vol] bromophenol blue in ultrapure water) on ice. Equal amounts of cellular proteins were separated on 10% SDS-PAGE gels, immunoblotted with the indicated antibodies, and visualized using the SuperSignal West Pico Chemiluminescent Substrate (34580; Thermo Fisher Scientific). The primary antibodies used for IB were as follows: β-actin (AC-15; BM5422; Boster Biological Technology); BIP (C50B12; 3177, RRID: AB_2119845; Cell Signaling Technology); t-PERK (C33E10; 3192, RRID: AB_2095847; Cell Signaling Technology); p-PERK (16F8; 3179, RRID: AB_2095853; Cell Signaling Technology); p-eIF2α (119A11; 3597, RRID: AB_390740; Cell Signaling Technology); ATF4 (D4B8; 11815, RRID: AB_2616025; Cell Signaling Technology); XBP1-S (E9V3E; 40435, RRID: AB_2891025; Cell Signaling Technology); C/EBPβ (#3087; 3087, RRID: AB_2078052; Cell Signaling Technology) for LAP; C/EBPβ (1H7; ab15050, RRID: AB_301598; Abcam) for LAP*/LAP/LIP; and CHOP (L63F7; 2895, RRID: AB_2089254; Cell Signaling Technology).
Liu M., Wu C., Luo S., Hua Q., Chen H.T., Weng Y., Xu J., Lin H., Wang L., Li J., Zhu L., Guo Z., Zhuang S.M., Kang T, & Zheng L. (2022). PERK reprograms hematopoietic progenitor cells to direct tumor-promoting myelopoiesis in the spleen. The Journal of Experimental Medicine, 219(4), e20211498.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!