As described in previous studies [20 (link)], the frozen plates with sorted dsDNA-specific single B cells were thawed at room temperature, and reverse transcription was carried out by adding 3 μL of 50 μM random hexamers (Invitrogen), 1 μL of 10 mM dNTP mix (Invitrogen), and 1 μL of SuperScript III (Invitrogen) into each well. The mixture was incubated at 25 °C for 10 min, 50 °C for 50 min, and 85 °C for 5 min. IgH, Igκ, and Igλ genes were amplified from cDNA. All PCRs were performed in 96-well PCR plates in a total volume of 25 μL containing 5 μL of 5× HotStar HiFidelity PCR buffer, 1 μL of primer (20 μM), and 0.25 μL of HotStar HiFidelity Polymerase (Qiagen). Each round of PCR was initiated at 94 °C for 5 min, followed by 40 cycles of 94 °C for 30 s, 58 °C 60 s, and 72 °C for 1 min, followed by 72 °C for 10 min. The positive products were selected for direct sequencing or subsequently cloned into the corresponding expression vectors as previously described [21 (link)]. The recombinant plasmids were co-transfected into 293 T cells with equal amounts of paired heavy and light chains using Lipofectamine 3000 (Invitrogen). The full length of IgGs was expressed and purified using Protein A/G Agarose (ThermoFisher, Waltham, MA).
Hotstar hifidelity pcr buffer
Manufactured by Qiagen
Sourced in Germany
HotStar HiFidelity PCR Buffer is a high-fidelity PCR buffer designed for accurate and efficient DNA amplification. It is formulated to provide enhanced specificity and sensitivity for PCR applications.
Automatically generated - may contain errors
Lab products found in correlation
Hotstar hifidelity dna polymerase, by Qiagen (3 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
Protein a g agarose, by Thermo Fisher Scientific (1 mentions)
Random hexamer, by Thermo Fisher Scientific (1 mentions)
Superscript 3, by Thermo Fisher Scientific (1 mentions)
Dntp mix, by Thermo Fisher Scientific (1 mentions)
Hotstar hifidelity polymerase, by Qiagen (1 mentions)
Qiaquick pcr purification kit, by Qiagen (1 mentions)
Eon spectrophotometer, by Agilent Technologies (1 mentions)
Ez seq service, by Macrogen (1 mentions)
Quick load 2 log dna ladder, by New England Biolabs (1 mentions)
Quick dna miniprep plus kit, by Zymo Research (1 mentions)
Ampure xp kit, by Beckman Coulter (1 mentions)
4 protocols using hotstar hifidelity pcr buffer
1
Cloning and Expression of Monoclonal Antibodies
2
Genomic DNA Extraction and Amplification of rib Regulatory Region in L. plantarum
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromosomal DNA from L. plantarum wild-type strains and their derivatives were obtained with the Microbial DNA extraction kit (Cabru, Milan, Italy) according to the manufacturer’s instructions. Quantity and quality of genomic DNA were assessed using a BioTek Eon spectrophotometer (BioTek, Winooski, VT, United States) and by visualization on 0.8% agarose gel. The primers RFNFpl (CAGCGCCTTGTTTGAT) and RFNR (TGGCCGTCTTTGACTA) (Macrogen, Madrid, Spain) were used to amplify a 649-bp fragment including the rib regulatory region. The PCR were carried out in a 25-μL volume reaction containing 20 ng of genomic DNA, 5 μL of 5× HotStar HiFidelity PCR Buffer, 0.2 nm of each primer, and 2.5 U/μL of the HotStar HiFidelity DNA Polymerase (Qiagen, Hilden, Germany). The thermal profile of the PCR was as follows: 95°C for 5 min, 35 cycles of 95°C for 30 s, 53°C for 45 s, 72°C for 75 s, and a final extension at 72°C for 7 min. Clean-up was performed by using a QIAquick PCR purification kit (Qiagen), and quantification and purity of the amplicons were determined spectrophotometrically and by visualization on 1.2% agarose gel. Sequencing was performed according to the EZ-seq service (Macrogen). Multiple sequence alignments of the RFN were performed using the Clustal Omega program1 .
3
CHO Cell DNA Extraction and Genotyping
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from 106 CHO cells by the Quick-DNA Miniprep Plus Kit (Zymo Research) according to the manufacturer’s instruction. Following genotyping primer sequences flanking the integration side of the expression cassette in the C12orf35 locus were designed: GT-C12-T2-FW 5′-TGCATGCACCACAGAGTCAT-3′ and GT-C12-T2-RV 5′-ACAGGGCGCTTTGATGGTAA-3´. Genotyping PCR was performed by combining 0.5 µM of each primer, 5 ng/µL genomic DNA, 1x HotStar HiFidelity PCR Buffer (Qiagen), 0.05 U/µl HotStar HiFidelity DNA Polymerase (Qiagen) and distilled water in a 20 µL reaction. The following temperature profile was used: 95°C for 5 min; 40 cycles of 94°C for 15 s, 62°C for 60 s, 68°C for 5 min; 72°C for 10 min. PCR-products were run on a 1% agarose gel and product size was analyzed by comparing them to the Quick-Load 2-Log DNA Ladder (0.1–10.0 kbp, New England Biolabs).
4
Microbiome Profiling from Dry Swabs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Dry swabs were collected in ambient conditions and then brought back to the lab within 0.5 h and stored in a − 20 °C freezer. Samples were then shipped to the University of North Carolina Microbiome Core Facility on ice, where DNA amplification, library preparation, and sequencing were carried out. Briefly, DNA was extracted from the swabs using a commercial DNA isolation kit (Qiagen, Valencia, CA) per the manufacturer’s protocol. The 16S ribosomal gene region V1-V2 was amplified (forward primer: AGAGTTTGATCCTGGCTCAG, reverse primer: GCTGCCTCCCGTAGGAGT) with PCR cocktails containing 50 ng of DNA template, HotStar Hi-fidelity DNA polymerase (Qiagen, Valencia, CA), HotStar Hi-Fidelity PCR buffer with dNTPs, and 0.4 µM of each primer. The cycling parameters were 35 cycles of 60 s 94 °C, 60 s 50 °C, and 60 s 72 °C, followed by a final extension at 72 °C for 10 min. Libraries were prepared by purifying the amplicons using the AMPure XP kit (Beckman Coulter) and then barcoding the amplicons with 10–12 basepair sequence tags for sequence multiplexing. Samples, a sterile swab, and no template controls were run on two runs on the Ion Torrent PGM platform, using 318 chips with 200/400 single-read sequencing [31 (link)].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!