Small RNA quantitative real-time-PCR was done with TaqMan reagents and custom probes targeting miR-1 (Life Technologies, assay name: hsa-miR-1, 4427975), miR-58a-3p (sequence: TGAGATCGTTCAGTACGGCAAT), miR-35–3p (sequence: TCACCGGGTGGAAACTAGCAGT), 21UR-1 (sequence: TGGTACGTACGTTAACCGTGC), and 22G-rRNA (sequence: GAAGAAAACTCTAGCTCGGTCT) following the manufacturer’s recommendations (Life Technologies, 4331348). Pri-miR-58 qRT-PCR was done with custom TaqMan probe sets targeting pri-miR-58 and act-1. pash-1 and drsh-1 mRNA qRT-PCR analysis was done using SYBR Green and the following primers: pash-1, GTTCACTCGTGTCGTCACTC and CGTTTTCGTGCAGCTCATCC; drsh-1, GTACTTGGAATCGAAGGACC and AGATTAGCCAAAGCCAGCTC; rpl-32 (housekeeping gene), CATGAGTCCGACAGATACCG and ACGAAGCGGGTTCTTCTGTC. Ct values were captured using a CF96 Real-Time PCR Detection System (Bio-Rad) and averaged across three technical replicates for each of 3 biological replicates. The 2-ddCt method was used to calculate relative fold changes between conditions66 (link). Two-sample t-tests were used to calculate P values.
Hsa mir 1
Manufactured by Thermo Fisher Scientific
Sourced in United States
Hsa-miR-1 is a synthetic microRNA (miRNA) that corresponds to the human miRNA-1. miRNAs are short, non-coding RNA molecules that play a regulatory role in gene expression. The core function of Hsa-miR-1 is to facilitate the study of miRNA expression and function in biological systems.
Automatically generated - may contain errors
2 protocols using hsa mir 1
1
Quantifying Small RNA Expression via qRT-PCR
2
Quantifying miRNA expression in blood samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Since the expression of miRNAs in the blood is very low, spectrophotometry is not reliable for quantification. In order to compensate for potential variations we added cel-miR-39 as a loading control (see above) and used a fixed volume of input RNA eluate as it was described before [16 (link)]. Total cDNA was synthesized from total RNA (5 μl), following the manufacturer´s instructions. TaqMan MicroRNA Reverse Transcription Kit (Life Technologies, USA) was used for multiplex reverse transcription reactions carried out with the primer sets for hsa-miR-1 (Life Technologies, USA), hsa-miR-21 (Life Technologies, USA), hsa-miR-29b (Life Technologies, USA) and cel-miR-39 (Life Technologies, USA) (used as loading control for extraction efficiency). The reactions were incubated in a Research Thermal Cycler (Applied Biosystems, USA (at Copenhagen site) or Bio Rad iQ, Germany (at Munich site)) for 30 min at 16°C, 30 min at 42°C, 5 min at 85°C and then held at 4°C.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!