Abi 7900 fast real time detection system

Total RNA of lung tissues was extracted by Trizol (Invitrogen), and cDNA was synthesized using First Strand cDNA Synthesis Kit (Thermo Scientific). The qPCR was performed using a 40‐cycle two‐step PCR with sequence‐specific primer pairs on the ABI 7900 fast real‐time detection system (Invitrogen). Primers were designed using Primer 5.0 software and the sequences of ROR2 were as follows: forward, 5′‐GTCCAACGCACAGCCCAAATC‐3′ and reverse, 5′‐CCGGTTGCCAATGAAGCGTG‐3′. The primer sequences of glyceraldehyde phosphate dehydrogenase (GAPDH) as the housekeeping control was forward, 5′‐GGAGCGAGATCCCTCCAAAAT‐3′ and reverse, 5′‐GGCTGTTGTCATACTTCTCATGG‐3′.

Total RNA was extracted from pulmonary tissues using TRIzol reagent (Invitrogen Life Technologies) according to the manufacturer’s instructions. qPCR kits (Takara, Kyoto, Japan) were used for the qPCR experiment. Total RNA (4 μg) templates were used to make cDNA by using AMV reverse transcriptase and random primers (9-mer) as the first strand primer. Synthesized cDNA was used in qPCR experiments. qPCR was performed using a 40-cycle two-step PCR with sequence-specific primer pairs using the ABI 7900 fast real-time detection system (Invitrogen Life Technologies). The qPCR cycling conditions were: 95°C for 10 min, 40 cycles of 95°C for 15 sec and 60°C for 1 min, then 95°C for 1 min, followed by dissociation curve analysis. The qPCR reagents used in were from the GoTaq^® qPCR Master Mix (A6001; Promega Corporta). Primers were designed using the Primer Express 3.0 software and the sequences were as follows: MMP9: Forward, 5′-AAAGACCTGAAAACCTCCAACCT-3′, and reverse, 5′-GCCCGGGTGTAACCATAGC-3′; TNF-α: forward, 5′-GAAGTTCCCAAATGGCCTCC-3′, and reverse, 5′-GTGAGGGTCTGGGCCATAGA-3′; P65: forward, 5′-GGTCCACGGCGGACCGGT-3′, and reverse, 5′-GACCCCGAGAACGTGGTGCGC-3′. The levels of mRNA expression were evaluated as a ratio based on the qPCR results for lung tissue GAPDH mRNA using the 2^−ΔΔCt method.