The largest database of trusted experimental protocols

Casein kinase 2 ck2 p60105 recombinant protein

Manufactured by New England Biolabs

Casein kinase II (CK2 - P60105) recombinant protein is a purified, active form of the CK2 enzyme. CK2 is a serine/threonine protein kinase that phosphorylates a wide range of protein substrates involved in cellular processes such as cell growth, differentiation, and survival.

Automatically generated - may contain errors

2 protocols using casein kinase 2 ck2 p60105 recombinant protein

1

Mutagenesis and siRNA Targeting of Che-1 and CK2

Check if the same lab product or an alternative is used in the 5 most similar protocols
Myc-Che-1 has already been described [12 (link), 27 (link)]. pCI-HDAC 1 was a kind gift from Dr. Sartorelli, while pSG5 Large T (pSG5 SV40 LT) plasmid was a gift from William Hahn (Addgene plasmid #9053; http://n2t.net/addgene:9053; RRID: Addgene_9053). Myc-Che-1 3S and pSG5 SV40 LT 3S were generated by in vitro mutagenesis using the QuikChange site-directed Mutagenesis system (Agilent Technologies) following the manufacturer’s instructions. PCR reactions were achieved using the following primers:
Myc- Che-1 3S:

Forward 5′ - GCCCAATGCGGGAGGTGAGGAGATTGCTGGTGAAGATGATGAGC - 3′

Reverse 5′ - GCTCATCATCTTCACCAGCAATCTCCTCACCTCCCGCATTGGGC - 3′

pSG5 SV40 LT 3S:

Forward 5′ - AACCTGTTTTGCGCAGAAGAAATGCCAGCTGGTGATGATGAGGCT - 3′

Reverse 5′ - AGCCTCATCATCACCAGCTGGCATTTCTTCTGCGCAAAACAGGTT - 3′

All mutations were confirmed by sequencing realized by Eurofins Genomics.
Stealth siRNA oligonucleotides targeting Che-1 (siChe-1), CSNK2A (siCK2), control sequence (siControl) and custom Che-1 3’UTR (sense 5′-CCCGCCUUUAAACGCCACAAAUAAA-3′; antisense 5′-UUUAUUUGUGGCGUUUAAAGGCGGG-3′) were purchased from Thermo Fisher Scientific. TBB (4,5,6,7 – Tetrabromobenzotriazole) was purchased from SelleckChem. Casein kinase II (CK2 - P60105) recombinant protein and Adenosine 5′-triphosphate (ATP - P07565) were purchased from New England BioLabs.
+ Open protocol
+ Expand
2

Characterizing Che-1 and CK2 Interaction

Check if the same lab product or an alternative is used in the 5 most similar protocols
Myc-Che-1 has already been described (11, 26) . pCI-HDAC 1 was a kind gift from Dr. Sartorelli, while pSG5 Large T (pSG5 SV40 LT) plasmid was a gift from William Hahn (Addgene plasmid #9053; http://n2t.net/addgene:9053; RRID: Addgene_9053). Myc-Che-1 3S and pSG5 SV40 LT 3S were generated by in vitro mutagenesis using the QuikChange site-directed Mutagenesis system (Agilent Technologies) following the manufacturer's instructions. PCR reactions were achieved using the following primers: Myc-Che-1 3S: Stealth siRNA oligonucleotides targeting Che-1 (siChe-1), CSNK2A (siCK2), control sequence (siControl) and custom Che-1 3'UTR (sense 5'-CCCGCCUUUAAACGCCACAAAUAAA-3'; antisense 5'-UUUAUUUGUGGCGUUUAAAGGCGGG-3') were purchased from Thermo Fisher Scienti c. TBB (4,5,6,7 -Tetrabromobenzotriazole) was purchased from SelleckChem. Casein kinase II (CK2 -P60105) recombinant protein and Adenosine 5'-triphosphate (ATP -P07565) were purchased from New England BioLabs.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!