Total rna purification kit

Total RNA was isolated using the Norgen Biotek Total RNA Purification Kit (Norgen Biotek Corp., Ontario, Canada) according to manufacturer’s instructions. RNA was reverse transcribed and subjected to quantitative real-time PCR using Power SYBR Green Master Mix (Applied Biosystems, Grand Island, NY, USA) as previously described [3 (link)]. The following primers were used: GAPDH (forward primer, 5ʹ-ATT CCC TGG ATT GTG AAA TAG TC-3′; reverse primer, 5′-ATTAAAGTCACCGCCTTCTGTAG-3′), CD38 (forward primer, 5′-GCTCAATGGATCCCGCAGT-3′; reverse primer, 5′-TCCTGGCARAAGTCTCTGG-3′), and TRAIL (forward primer 5′-AAG GCT CTG GGC CGC AAA ATA AAC-3′and reverse primer 5′-GCC AAC TAA AAA GGC CCC GAA AAA-3′). GAPDH was used for normalization of the genes of interest. Data were presented as mean relative copy number for at least three separate experiments using relative copy number = 2^−ΔCt × 100 [72 (link)], where ΔCt is the Ct_target − Ct_GAPDH.

RNA was isolated using the Total RNA Purification Kit (Norgen Biotek, Thorold, Canada). One microgram of the total RNA was reverse-transcribed using the iScript cDNA Synthesis Kit (BioRad, Hercules, CA, USA). qRT-PCR was performed using either the SYBR Green PCR Master Mix (Life Technologies) or the SYBR Green (Roche) with the following primers: TGFBI (Forward: GTCCACAGCCATTGACCTTT, Reverse: GAGTTTCCAGGGTCTGTCCA); PTEN (Forward: TTGGCGGTGTCATAATGTCT, Reverse: GCAGAAAGACTTGAAGGCGTA); PAI-1 (Forward: GGCCATTACTACGACATCCTG, Reverse: GGTCATGTTGCCTTTCCAGT); ZEB1 (Forward: GTTCTGCCAACAGTTGGTTT, Reverse: GCTCAAGACTGTAGTTGATG); VIM (Forward: TGACCTCTCTGAGGCTGCCAACC, Reverse: TTCCATCTCACGCATCTGGCGCTC); CDH1 (Forward: CACCCTGGCTTTGACGCCGA, Reverse: AAAATTCACTCTGCCCAGGACGCG); CDH2 (Forward: CGCCATCCAGACCGACCCAA, Reverse: GTCGATTGGTTTGACCACGGTGAC); β-actin (Forward: AGAGCTACGAGCTGCCTGAC, Reverse: AGCACTGTGTTGGCGTACAG); GAPDH (Forward: TGTTGCCATCAATGACCCCTT, Reverse: CTCCACGACGTACTCAGCG); and HPRT (Forward: ATGAACCAGGTTATGACCTTGAT, Reverse: CCTGTTGACTGGTCATTACAATA). The 2^−ΔΔCt method was used to calculate the relative miRNA expression^{64 (link)}. The mRNA expression levels were normalized to the average expression of three housekeeping genes (β-actin, GAPDH, and HPRT).

Total RNA from the mice’s ankle tissues was isolated according to the manufacturer’s instructions (Total RNA purification kit, Norgen Biotek Corp, Thorold, ON, Canada). RNA quality was examined using a NanoDrop Lite spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA), and then reverse-transcribed using an iScript™ Reverse Transcription Supermix (Bio-Rad, Milano, Italy) according to the manufacturer’s instructions. Amplification of IL-1β and CXCL1 genes was undertaken by an ABI Prism 7900HT (Applied Biosystems, Foster City, CA, USA), and were analyzed in duplicate for each sample. PCR reaction using iTaq Universal SYBR Green Supermix (BioRad, Hercules, CA, USA) was run at the following thermal cycling conditions: 95 °C for 30 s, followed by 40 cycles at 95 °C for 15 s and 60 °C for 1 min. Levels of mRNA for each target gene were normalized to 18S as reference gene and calculated according to the 2^−ΔΔCt method [12 (link)]. The sequences of primers used are as follow:

IL-1ß Forward: 5′-CGCAGCAGCACATCAACAAG-3′

Reverse: 5′-GTGCTCATGTCCTCATCCTG-3′

CXCL1 Forward: 5′-ATCCAGAGCTTGAAGGTGTTG-3′

Reverse: 5′-GTCTGTCTTCTTTCTCCGTTACTT-3′

18. S Forward: 5′ GGGAGCCTGAGAAACGGC 3′

Reverse: 5′ GGGTCGGGAGTGGGTAATTT 3′

Total RNA was extracted using Total RNA Purification Kit® (Norgen, Biotek Corp.) Reverse transcription was performed using the High Capacity RNA-to-cDNA™ Kit (Applied Biosystems®). The TaqMan® assays used were: HIF1A: Hs00936366_m1; VEGFA: Hs99999070_m1; GPER: Hs01922715_s1; ATM: Hs01112307_m1. Real-time quantitative PCR analyses were performed in triplicate on a 7900 HT Fast Realtime System. Peptidylprolyl isomerase B (cyclophilin B) (PPIB) (Hs00168719_m1) [37 (link)] or 18S rRNA (Hs99999901_s1) were used for normalization. A relative fold change in expression of the target gene transcript was determined using the comparative cycle threshold method (2^-ΔΔCT) [38 (link)]. A Ct value of 35 represents single molecule template detection, and so where Ct values are ≥35 the target gene is considered not expressed [39 (link)].

Total RNA was extracted using the total RNA purification kit (Norgen Biotek) following the manufacturer’s instructions. The cDNA preparation was completed using the High-Capacity cDNA Reverse Transcription kit (Thermo Fisher). Quantitative real-time PCR was carried out using the QuantStudio 12 K Flex (Applied Biosystems) thermocycler in combination with the Roche UPL system and the TaqMan Fast Universal PCR Master Mix (Applied Biosystems).
Primer sequences are shown in Supplementary file 10. Graphs were generated using GraphPad Prism (GraphPad Software), which was also employed for statistical analysis.