Primescript reverse transcription kit

Manufactured by Vazyme

Sourced in China

The PrimeScript Reverse Transcription Kit is a laboratory product designed for the reverse transcription of RNA into cDNA. It contains the necessary reagents and enzymes required to perform this fundamental molecular biology procedure.

Automatically generated - may contain errors

Lab products found in correlation

Rneasy plus micro kit, by Qiagen (3 mentions) Abi 7500 real time pcr system, by Thermo Fisher Scientific (2 mentions) Abi 7500 machine, by Thermo Fisher Scientific (2 mentions) Trizol reagent, by Thermo Fisher Scientific (2 mentions) Ds 11 spectrophotometer, by DeNovix (1 mentions) Rnaex pro reagent, by Accurate Biology (1 mentions) Sybr premix ex taq polymerase, by Takara Bio (1 mentions) Qtower 2.2 system, by Analytik Jena (1 mentions) Sybr premix ex taq kit, by Vazyme (1 mentions) Trizol, by Tiangen Biotech (1 mentions) Sybr green mix, by Vazyme (1 mentions) Abi 7300 system, by Thermo Fisher Scientific (1 mentions) Annexin 5 fitc cell apoptosis detection kit, by Solarbio (1 mentions) Cck 8 assay kit, by Dojindo Laboratories (1 mentions) Penicillin and streptomycin, by Thermo Fisher Scientific (1 mentions) Sybr premix ex taq 2 kit, by Vazyme (1 mentions) Rna easy isolation reagent, by Vazyme (1 mentions) Bca protein concentration assay kit, by Thermo Fisher Scientific (1 mentions)

Spelling variants of this product

Reverse transcription kit (388 citations)

8 protocols using primescript reverse transcription kit

Quantitative Analysis of Lipid Metabolism Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted with RNAex pro reagent (Accurate Biotechnology (Human) Co., Ltd., Changsha, China). The total RNA concentration was measured by DS-11 Spectrophotometer (Denovix, USA) and 500 ng RNA was reversed to cDNA using a Primescript Reverse Transcription kit (Vazyme, Nanjing, China). RT-qPCR analysis of cDNA was performed using SYBR PCR mix (Vazyme, Nanjing, China) on a StepOne Real-Time PCR machine (ABI, Carlsbad, CA). Three repetitions per reaction. Quantitating relative levels of mRNA were calculated using the 2^-∆∆Ct algorithm. ACTB was used as an internal reference. Primer sequences used for RT-qPCR are listed in Table 1.

Table 1

Primer sequences used in this study (Sus scrofa)

Gene name	Forward (5′ to 3′)	Reverse (5′ to 3′)	Size, bp	Accession No.s
CD36	TGGGTTAAAACAGGCACGGA	TGCCACAGCCAGATTGAGAA	270	XM_021102279
SCARB1	GCTGTTCATCCCCATCGTCT	GGCCTGAATGGCCTCCTTAT	103	NM_213967
DGAT2	TCACAGTGGGTCCGAAACTG	GACATCAGGTACTCCCGCAG	260	NM_001160080
HMGCR	GCGCTTGCTGTGAGAATGTT	TGCTCTGCAGCCTCTATTGG	146	NM_001122988
ACAT2	ACAGTCACCCCAGCTAATGC	TGCTAAAGGAGTAAGCCCGC	102	XM_001928345
CYP19A1	TCCGCAATGACTTGGGCTAC	GCCTTTTCGTCCAGTGGGAT	103	NM_214429
CYP19A3	AGTGCCCTCGTGCATAAAGT	CGCCACGTTTCTCAGCAAAA	238	NM_214431
CYP11A1	GGGCAACCCATTTCCTACCA	CGAGCACTGGTGGTACAGAC	95	KX108746
StAR	CGTTTAAGCTGTGTGCTGGG	TCCATGACCCTGAGGTTGGA	132	NM_213755
ACTB	TCCCTGGAGAAGAGCTACGA	CGCACTTCATGATCGAGTTG	154	NC_010445

Zhou X., Mo Z., Li Y., Huang L., Yu S., Ge L., Hu Y., Shi S., Zhang L., Wang L., Gao L., Yang G, & Chu G. (2022). Oleic acid reduces steroidogenesis by changing the lipid type stored in lipid droplets of ovarian granulosa cells. Journal of Animal Science and Biotechnology, 13, 27.

+ Open protocol

+ Expand

Quantitative Expression Analysis of Target Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

To further assess the expression of target genes in the transfected cells, total RNA was extracted from transfected cells using the RNeasy Plus Micro Kit (Qiagen, Düsseldorf, Germany), according to the manufacturer’s instructions. A PrimeScript Reverse Transcription Kit (Vazyme, Nanjing, China) was then used for reverse transcription, and the SYBR Premix Ex Taq polymerase (Takara, Dalian, China) were used to conduct the qRT-PCR on an ABI 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). 18S ribosomal (r)RNA was used as an endogenous control and expression was calculated using the 2^−ΔΔCt method. The following primers were used in the qRT-PCR reaction: BAG3 forward 5′-CCGGGCTGGGAGATCAAAAT-3′ and reverse 5′-GGCTGAAGATGCAGTGTCCTTA-3′; and 18S rRNA forward 5′-AAACGGCTACCACATCCAAG-3′ and reverse 5′-CCTCCAATGGATCCTCGT TA-3′.

Liu Y., Xu R., Xu J., Wu T, & Zhang X. (2023). BAG3 regulates bone marrow mesenchymal stem cell proliferation by targeting INTS7. PeerJ, 11, e15828.

+ Open protocol

+ Expand

Quantitative PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using the RNeasy Plus Micro Kit (Qiagen, Duesseldorf, Germany), according to the instructions of manufacturer. cDNA synthesis was carried out using the PrimeScript Reverse Transcription Kit (Vazyme, Nanjing, China). SYBR green-based quantitative PCR was performed by an ABI 7500 machine (Applied Biosystems, Foster City, CA, USA). Internal control was done using 18 S rRNA. The primers used in this study were as followings: Bmi1, forward 5ʹ- CTCGCTCCAAGATGGCCG-3ʹ and reverse 5ʹ- ATAAAAGATCCCGGAAAGAGCG-3ʹ; 3β-HSD, forward 5ʹ- TGGACAAAGTATTCCGACCAGA-3ʹ and reverse 5ʹ-GGCACACTTGCTTGAACACAG-3ʹ; 17β-HSD, forward 5ʹ-ACTTGGCTGTTCGCCTAGC-3ʹ and reverse 5ʹ- GAGGGCATCCTTGAGTCCTG-3ʹ; 18sRNA, forward 5ʹ- AAACGGCTACCACATCCAAG −3ʹ and reverse 5ʹ- CCTCCAATGGATCCTCGTTA −3ʹ.

Gao T., Lin M., Shao B., Zhou Q., Wang Y., Chen X., Zhao D., Dai X., Shen C., Cheng H., Yang S., Li H., Zheng B., Zhong X., Yu J., Chen L, & Huang X. (2020). BMI1 promotes steroidogenesis through maintaining redox homeostasis in mouse MLTC-1 and primary Leydig cells. Cell Cycle, 19(15), 1884-1898.

+ Open protocol

+ Expand

RNA Extraction and qPCR Amplification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from tumor tissues using Trizol (Tiangen Biotech, Beijing, China). Complementary DNA was generated using the PrimeScript™ reverse transcription kit (Vazyme, China) and PCR amplification was performed with the SYBR® Premix Ex Taq™ kit (Vazyme) according to the manufacturer's instructions. PCR reactions were analyzed using the qTOWER2.2 System (Analytik Jena, Germany). All primers were synthesized by Shanghai Biological Engineering Co. (Shanghai, China) (Table 1).

Zhang J., Qi Y.P., Ma N., Lu F., Gong W.F., Chen B., Ma L., Zhong J.H., Xiang B.D, & Li L.Q. (2020). Overexpression of Epcam and CD133 Correlates with Poor Prognosis in Dual-phenotype Hepatocellular Carcinoma. Journal of Cancer, 11(11), 3400-3406.

+ Open protocol

+ Expand

RNA Extraction and Quantification in BM-MSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

The RNeasy Plus Micro Kit (Qiagen, Düsseldorf, Germany) was used to extract total RNA from BM-MSCs, according to the manufacturer’s instructions. RNA was reverse transcribed into cDNA using the PrimeScript Reverse Transcription Kit (Vazyme, Nanjing, China). SYBR green-based quantitative PCR was performed using an ABI 7500 machine (Applied Biosystems, Foster City, CA, United States). All results were normalized against 18S rRNA expression. The primers used in this study are summarized in Supplementary Table 1.

Liu Y., Yu X., Huang A., Zhang X., Wang Y., Geng W., Xu R., Li S., He H., Zheng B., Chen G, & Xu Y. (2021). INTS7–ABCD3 Interaction Stimulates the Proliferation and Osteoblastic Differentiation of Mouse Bone Marrow Mesenchymal Stem Cells by Suppressing Oxidative Stress. Frontiers in Physiology, 12, 758607.

+ Open protocol

+ Expand

Quantitative Expression Analysis of Mouse Map3k3

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cellular RNA was extracted using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. Total RNA was reverse transcribed into cDNA using a PrimeScript Reverse Transcription Kit (Vazyme) according to the instructions of the manufacturer. A total of 1 μL of the synthesized cDNA was mixed with a SYBR green mix (Vazyme) and primers in a final volume of 20 μL and applied to an ABI 7500 Real-Time PCR system (Applied Biosystems, Foster City, CA, United States). Relative gene expression levels were calculated using the 2^−ΔΔCt method with 18S rRNA serving as an internal control. The following primers were used: mouse Map3k3, forward 5′-GACTTCAGGACTCGCAGGC-3′ and reverse 5′-TGTTCATCCATGGTGGCGAT-3′; mouse 18sRNA, forward 5′-AAACGGCTACCACATCCAAG-3′ and reverse 5′-CCTCCAATGGATCCTCGTTA-3′.

Yu J., Wu Y., Li H., Zhou H., Shen C., Gao T., Lin M., Dai X., Ou J., Liu M., Huang X., Zheng B, & Sun F. (2021). BMI1 Drives Steroidogenesis Through Epigenetically Repressing the p38 MAPK Pathway. Frontiers in Cell and Developmental Biology, 9, 665089.

+ Open protocol

+ Expand

Quantification of CXCL16 and ERK2 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

mRNA was extracted from cells (1×10⁷/ml) and tissues (20 mg) using TRIzol^® reagent (Thermo Fisher Scientific, Inc.) and was reverse transcribed into cDNA using the PrimeScript Reverse Transcription kit (Vazyme Biotech Co. Ltd), the temperature protocol used for reverse transcription was as follows: 50°C for 20 min and 85°C for 2 min. qPCR was performed using the ABI-7300 System (Applied Biosystems; Thermo Fisher Scientific, Inc.) in a total volume of 20 µl according to the manufacturer's protocols. The primers sequences used were as follows: CXCL16 forward, 5′-AAACCACCATTCACACTGCG-3′ and reverse, 5′-GAGTCAGGTGCCACAGGTAT-3′; ERK2, forward, 5′-GATCTGTGACTTTGGCCTGG-3′; and reverse, 5′-TGTGGTTCAGCTGGTCAAGA-3′; β-actin, forward, 5′-GGCATCCTCACCCTGAAGTA-3′; and reverse, 5′-GGGGTGTTGAAGGTCTCAAA-3′. The following thermocycling conditions were used for qPCR: 95°C for 5 min; 40 cycles of 95°C for 10 sec and 60°C for 30 sec. Relative gene expression was determined using the 2^−ΔΔCq method (25 (link)) using β-actin as an internal control.

Chen Y., Wang Z., Li Q., Tian M., Zhu Y., Yu L., Wang J, & Sun S. (2022). CXCL16/ERK1/2 pathway regulates human podocytes growth, migration, apoptosis and epithelial mesenchymal transition. Molecular Medicine Reports, 25(6), 212.

+ Open protocol

+ Expand

Exosome isolation and characterization protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

For cell culture, Dulbecco's Modified Eagle Medium high‐glucose (DMEM‐H) were purchased from Hyclone (Boston, USA); antibiotic mixture (Penicillin and Streptomycin) was obtained from Invitrogen (CA, USA); exosome free foetal bovine serum was purchased from ABW (Uruguay). For Western blotting, primary antibodies against CD63, flotillin‐1, and calnexin were obtained from CST (USA); goat anti‐rabbit and goat anti‐mouse horseradish peroxidase conjugates were purchased from Proteintech (USA); BCA protein concentration assay kit was purchased from Thermo Scientific (USA). For RT‐PCR, RNA‐easy Isolation Reagent, PrimeScript Reverse Transcription kit and SYBR Premix Ex Taq II kit were purchased from Vazyme (Nanjing, China). Size exclusion chromatography and filtration kit was purchased from ECHO Biotech (Beijing, China). CCK‐8 assay kit was purchased from Dojindo (Tokyo, Japan). ELISA kit (IL‐1β, IL‐6, TNF‐α and COX2) was purchased from Meibiao Biotechnology (Jiangshu, China). Annexin‐V—FITC cell apoptosis detection kit was purchased from Solarbio (Beijing, China).

Chen P., Zhou J., Ruan A., Guan H., Xie J., Zeng L., Liu J, & Wang Q. (2022). Synovial tissue‐derived extracellular vesicles induce chondrocyte inflammation and degradation via NF‐κB signalling pathway: An in vitro study. Journal of Cellular and Molecular Medicine, 26(7), 2038-2048.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!