Pad cmv v5 dest

Manufactured by Thermo Fisher Scientific

Sourced in United States

The PAd/CMV/V5-DEST is a gateway destination vector used for protein expression in mammalian cells. It contains the CMV promoter and V5 epitope tag for detection and purification of the expressed protein.

Automatically generated - may contain errors

Lab products found in correlation

Virapower adenoviral expression system, by Thermo Fisher Scientific (5 mentions) Lr clonase 2, by Thermo Fisher Scientific (4 mentions) Adeno x maxi purification kit, by Takara Bio (3 mentions) Adeno x rapid titer kit, by Takara Bio (3 mentions) Hek293a cells, by Thermo Fisher Scientific (3 mentions) Gateway expression system, by Thermo Fisher Scientific (2 mentions) Pentr4, by Thermo Fisher Scientific (2 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions) Polyethylenimine (pei), by Merck Group (2 mentions) Pspax2, by Cellecta (2 mentions) Pmd2 g, by Cellecta (2 mentions) Fugene 6, by Promega (2 mentions) Pd 10 column, by GE Healthcare (2 mentions) Pad pl dest, by Thermo Fisher Scientific (2 mentions) Adenovirus purification miniprep kit, by Biomiga (1 mentions) Pires2 egfp, by Takara Bio (1 mentions) Pires dsred, by Takara Bio (1 mentions) Pcdna3.1 empty vector, by GenePharma (1 mentions) Pcdna3.1 mettl3, by GenePharma (1 mentions) Quikchange 2 xl mutagenesis kit, by Agilent Technologies (1 mentions)

Spelling variants of this product

PAd/CMV/V5-DEST vector (38 citations) PAd/CMV/V5-DEST Gateway vector (14 citations) PAD/CMV/V5-DEST adenoviral vector (8 citations) PAd/CMV/V5-DEST Gateway recombination system (4 citations) PAd/CMV/V5-DEST Gateway Vector Kit (3 citations) PAd/CMV/V5-DEST expression vector (3 citations)

37 protocols using pad cmv v5 dest

Adenovirus-Mediated Overexpression and Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols

Recombinant adenovirus for the over-expression of Shc1 (pAd-Shc1) was generated as follows. The rat Shc1 gene was synthesized de novo by rapid polymerase chain assembly and cloned into the SpeI-SgsI site of pENTR-IRES-EGFP (Invitrogen). The adenoviral plasmid pAd-CMV-Shc1-IRES-EGFP was generated by LR clonase-mediated recombination using pAd-CMV-V5-DEST (Invitrogen) as the acceptor and the pENTR-Shc1-IRES-GFP (Invitrogen) as the donor. Recombinant adenoviruses were propagated in HEK293 cells and purified using the Adenovirus Purification Miniprep Kit (Biomiga V1160) following the manufacturer’s instructions.
The Olr81 targeting recombinant adenoviral pAd-miOlr81 was generated by cloning synthetic oligonucleotides encoding complimentary miRNAs for rat Olr81 mRNA into the pENTR-miR vector (Invitrogen), followed by homologous recombination with pAd-CMV-V5-DEST (Invitrogen). The sequence for the oligonucleotides was: 5’- TGCTGAGGAATGTGCTATTACATGAGGTTTTGGCCACTGACTGACCTCATGTAAGCACATTCCT -3’.

Wang J.Q., Qi R.R., Zhou W., Tang Y.F., Pan L.L, & Cai Y.L. (2015). Differential Gene Expression Profile in the Rat Caudal Vestibular Nucleus is Associated with Individual Differences in Motion Sickness Susceptibility. PLoS ONE, 10(4), e0124203.

+ Open protocol

+ Expand

Generation of Adenoviral Vectors for G Protein-Coupled Receptor Studies

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

To generate the adenoviral vector (Ad) encoding for the human MR, cDNA was first amplified from the Addgene Plasmid #23059 (ref. 53 (link)). Next, the MR PCR product was inserted into pIRES2-EGFP (Clontech, Mountain View, CA). This allows for co-expression of the GFP with the MR gene. The MRiGFP was then cloned into pAd/CMV/V5-DEST (Thermo Fisher Scientific). To generate the Ad-AT₁R, the cDNA encoding for the rat AT₁R with a N-terminal HA tag was subcloned into pIRESdsRed (Clontech). The AT₁RiRED was then cloned into pAd/CMV/V5-DEST (Thermo Fisher Scientific). The Ad-vector encoding for the bovine WT Grk2 gene (Ad-GRK2), for the WT Grk5 gene (Ad-GRK5) and one encoding for the C-terminal region containing the last 194 amino acids of GRK2 denominated βARKct (Ad-βARKct) were previously obtained54 (link)55 (link). The Ad-vector encoding for the mutated form of GRK5 lacking the nuclear localization signal (GRK5-ΔNLS) was obtained previously55 (link). The Ad-vector encoding the mutated form of GRK2 at Ser670 (GRK2-S670A) was previously obtained29 (link). Ad-GFP was used as a control.

Cannavo A., Liccardo D., Eguchi A., Elliott K.J., Traynham C.J., Ibetti J., Eguchi S., Leosco D., Ferrara N., Rengo G, & Koch W.J. (2016). Myocardial pathology induced by aldosterone is dependent on non-canonical activities of G protein-coupled receptor kinases. Nature Communications, 7, 10877.

+ Open protocol

+ Expand

Overexpression of METTL3 by Adenovirus

Check if the same lab product or an alternative is used in the 5 most similar protocols

pcDNA3.1-METTL3 and empty pcDNA3.1 vector were purchased from GenePharma (Shanghai, China). By referring to the previously described [20 (link)], the recombinant METTL3 overexpressing adenovirus vector were established. In brief, the full length of METTL3 was cut off from pcDNA3.1-METTL3 vector between Hind III and Xhol restriction endonuclease sites, and then connected to the pENTR1A-expressing vector (Life Technologies, Carlsbad, CA, USA) to construct pENTR1A-METTL3. After the LR reaction a recombination reaction between attL and attR sites using LR Clonase II enzyme mix, the pENTR1A-METTL3 and pAd/CMV/V5-DEST (ThermoFisher Scientific, Carlsbad, CA, USA) was recombined to form pAd/CMV/V5-DEST-METTL3 (pAd-METTL3). The recombined pAd-METTL3 were transfected into 293T cells to obtain purified virus particles.

Tian Y., Xiao Y.H., Sun C., Liu B, & Sun F. (2023). N6-Methyladenosine Methyltransferase METTL3 Alleviates Diabetes-Induced Testicular Damage through Modulating TUG1/Clusterin Axis. Diabetes & Metabolism Journal, 47(2), 287-300.

+ Open protocol

+ Expand

Adenoviral Transduction of PAICS in Lung Cells

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

PAICS cDNA (Origene, MD; Cat# RC223925) was cloned into Gateway expression system (Life Technologies CA). To generate adenoviral construct, PCR8-PAICS (flag tagged) was recombined with pAD/CMV/V5-Dest™ (Life Technologies, CA) respectively using LR Clonase II (Life Technologies, CA) [71 (link)]. Adenoviruses were generated by the University of Michigan Vector Core. Benign lung epithelial cells (BEAS2-B) were infected with adenoviruses expressing PA1CS or lacZ for transient over-expression.

Goswami M.T., Chen G., Chakravarthi B.V., Pathi S.S., Anand S.K., Carskadon S.L., Giordano T.J., Chinnaiyan A.M., Thomas D.G., Palanisamy N., Beer D.G, & Varambally S. (2015). Role and regulation of coordinately expressed de novo purine biosynthetic enzymes PPAT and PAICS in lung cancer. Oncotarget, 6(27), 23445-23461.

+ Open protocol

+ Expand

Generating adenovirus for LaNt α31 expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Full-length LAMA3LN1 was PCR amplified from cDNA generated from cultured human keratinocytes, then cloned into pCR2.1 (Life Technologies, Carlsbad, CA, USA) and sequence verified by DNA sequencing (DNA Sequencing and Services, University of Dundee). The native translational stop codon was converted to an AgeI restriction enzyme site by site-directed mutagenesis following the manufacturer's directions for QuikChange II XL mutagenesis kit (Agilent). The mutated LAMA3LN1 was then subcloned using KpnI and AgeI (New England Biolabs, Hitchin, UK) into pENTR4 (Life Technologies) with eGFP inserted into the BglII and KpnI sites of the multiple cloning site (a kind gift from Jonathan Jones, Washington State University, WA, USA). LR recombination was used to transfer the LAMA3LN1-eGFP construct from pENTR to pAD-CMV/V5-DEST (Life Technologies) and adenoviral particles produced following the standard gateway-adapted ViralPower adenoviral expression protocol (Life Technologies).
For cell transduction, 3 × 10⁵ pCEC were seeded in 60-mm dishes (Greiner Bio-One, Stonehouse, UK), then transduced with adenovirus in 4 mL media 24 hours after seeding. Analyses of LaNt α31-GFP (+LaNt α31), GFP (+GFP), or untreated cells were conducted 48 to 72 hours following transduction.

Barrera V., Troughton L.D., Iorio V., Liu S., Oyewole O., Sheridan C.M, & Hamill K.J. (2018). Differential Distribution of Laminin N-Terminus α31 Across the Ocular Surface: Implications for Corneal Wound Repair. Investigative Ophthalmology & Visual Science, 59(10), 4082-4093.

+ Open protocol

+ Expand

Transfection and Adenoviral Expression of Rho GTPases

Check if the same lab product or an alternative is used in the 5 most similar protocols

A7r5 cells were transfected using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s protocol. The siRNA was used to a final concentration of 25 nM, with the sequences specific for rat RhoG, 5-CGUCUUCGUCAUCUGUUUCUU-3; Cdc42 and Rac (ON-TARGETplus SMARTpool); and Trio, 5-GAACAUGAUUGACGAGCAU[dT][dT]-3. After 72 h of transfection, cells were serum starved for 2 h and then stimulated with 20 ng/ml PDGF-BB during 1 min for pull-down assays or 2.5 min for immunofluorescence assays.
The ViraPower Adenoviral Expression System (Life Technologies) was used for transient expression of human mycRhoG, mycRhoG Q61L, mycRac, mycRac Q61L, mycCdc42, and mycCdc42 Q61L, which were subcloned into pAd/CMV/V5-DEST using Gateway recombination according to the manufacturer’s instructions (Life Technologies). pAdeno-TrioD1-GFP was a gift of Jaap vanBuul (Sanquin, Netherlands). Adenovirus was prepared according to manufacturer’s recommendations (Life Technologies).
For the overexpression experiments or rescue, cells were infected for 48 h with the indicated viruses. The efficiency of the overexpression was further determined for each assay by immunoblotting using specific antibodies as indicated in the respective figures.

Valdivia A., Goicoechea S.M., Awadia S., Zinn A, & Garcia-Mata R. (2017). Regulation of circular dorsal ruffles, macropinocytosis, and cell migration by RhoG and its exchange factor, Trio. Molecular Biology of the Cell, 28(13), 1768-1781.

+ Open protocol

+ Expand

Generating Adenoviral Oip5 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Full-length cDNA of Oip5 from mouse colon were subjected to RT-PCR by using Pfu DNA polymerase (Promega, Madison, WI) with primers containing a restriction enzyme (XhoI and KpnI) cutting site at the end. Primer sets were as follows: 5′-AGGGTACCACCATGGCGACTCTCTCGCGCCGCAG-3′ and 5′-CCGCTCGAGTTACAGGATCTTTGGTGATGCTGTTAACC-3′. The amplicons were cloned into pENTRTM1A vector (Life technology, Carlsbad, CA, USA) using restriction enzyme sites. After confirmation of correct sequences, the gene encoding Oip5 in pENTRTM1A vector was transferred into the adenoviral expression vector (pAd/CMV/V5-DEST; Life technology, Carlsbad, CA, USA) by recombination following the manufacturer’s instructions. The resultant pAd/CMV plasmid containing the target gene was linearized by PacI digestion and were transfected into 293A cells by lipofectamine-2000 (Life technology, Carlsbad, CA, USA). On day 2 after transfection, the 293A cells were passaged and were cultivated until 80% of cells became detached. The cell suspension was then frozen and thawed three times. After centrifugation at 1,750×g for 15 min, the supernatant was used as the gene expression adenoviral preparation (Ad-Oip5). The titers for the adenoviral preparation were around 5×10⁸ plaque forming units (pfu)/mL. The adenovirus expressing β-galactosidase (Ad-βgal) was used as a control.

Inoue K., Maeda N., Mori T., Sekimoto R., Tsushima Y., Matsuda K., Yamaoka M., Suganami T., Nishizawa H., Ogawa Y., Funahashi T, & Shimomura I. (2014). Possible Involvement of Opa-Interacting Protein 5 in Adipose Proliferation and Obesity. PLoS ONE, 9(2), e87661.

+ Open protocol

+ Expand

Recombinant Fluorescent Protein Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols

mCherry-Tensin-C14 (a gift from Michael Davidson, Addgene plasmid #55143). mCherry-LifeAct (a gift from Jaap van Buul, Sanquin Institute, Amsterdam, Netherlands). GFP-EB3 (a gift from Kristen Verhey, University of Michigan, Ann Arbor, MI). Paxillin-GFP (a gift from Channing Der, UNC-Chapel Hill, Chapel Hill, NC) was subcloned into pAd/CMV/V5-DEST using Gateway recombination technology (Life Technologies). Virus particles were produced using the Virapower Adenoviral Expression System (Life Technologies). The shRNA resistant mycRhoG construct used for rescue experiments has been previously described^{14 (link)}.

Zinn A., Goicoechea S.M., Kreider-Letterman G., Maity D., Awadia S., Cedeno-Rosario L., Chen Y, & Garcia-Mata R. (2019). The small GTPase RhoG regulates microtubule-mediated focal adhesion disassembly. Scientific Reports, 9, 5163.

+ Open protocol

+ Expand

Overexpression of KLK4-KLKP1 in Prostate Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

KLK4-KLKP1 cDNA was PCR amplified using a forward primer with DDK tag and a reverse primer from KLK4-KLKP1 template and was cloned into the Gateway expression system (Life Technologies). To generate lentiviral and adenoviral constructs, PCR8-KLK4-KLKP1 (DDK tagged) was recombined with pLenti6/V5-Dest (Life Technologies) or pAD/CMV/V5-Dest (Life Technologies), respectively, using LR Clonase II (Life Technologies). For transient overexpression in HEK-293, RWPE-1, and PrEC cells, adenoviruses carrying KLK4-KLKP1, EZH2, or lacZ were added to the culture media after cells reached 50%-70% confluency. At the same time, cells were treated with or without bortezomib (100 nM in ethanol, 10 μl, Cayman Chemical, catalog #10008822). After incubation for 48 hours at 370°C, cells were harvested by scraping. For stable overexpression, RWPE-1 cells were infected with lentiviruses expressing KLK4-KLKP1 or lacZ, and stable clones were selected with blasticidin (3.5 μg/ml, Sigma-Aldrich, St Louis, MO). Lenti- and adenoviruses were generated by the University of Michigan Vector Core (Ann Arbor, MI).

Chakravarthi B.V., Dedigama-Arachchige P., Carskadon S., Sundaram S.K., Li J., Wu K.H., Chandrashekar D.S., Peabody J.O., Stricker H., Hwang C., Chitale D.A., Williamson S.R., Gupta N.S., Navone N.M., Rogers C., Menon M., Varambally S, & Palanisamy N. (2019). Pseudogene Associated Recurrent Gene Fusion in Prostate Cancer. Neoplasia (New York, N.Y.), 21(10), 989-1002.

+ Open protocol

+ Expand

Lentiviral and Adenoviral Transduction Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols

A lentiviral vector was co-transfected with psPAX2 and pMD2G (Cellecta, Mountain View, CA, USA) into HEK293T cells using polyethylenimine (PEI, Sigma, St. Louis, MO, USA) (6 μg PEI/μg plasmid) to generate lentivirus expressing miR-193b or the control. The pENTR-miRNA vector or miR-con was switched into an adenovirus vector using the Gateway technique pAd/CMV/V5-DEST^™ (Invitrogen, Carlsbad, CA, USA) as described by the manufacturer. Adenoviral vectors were then linearized with PacI before they were transfected to HEK293A cells. The virus was harvested and further amplified by re-infecting HEK293A cells. The adenovirus was eventually purified using the Adeno-X^™ Maxi Purification Kit (Clontech, Mountain View, CA, USA) according to the manufacturer’s instructions. Infectious units (IU) of both lenti- and adeno-miRNA viruses were determined by titration in HEK293T cells.

Yang X., Zhao C., Bamunuarachchi G., Wang Y., Liang Y., Huang C., Zhu Z., Xu D., Lin K., Senavirathna L.K., Xu L, & Liu L. (2019). miR‐193b represses influenza A virus infection by inhibiting Wnt/β‐catenin signalling. Cellular Microbiology, 21(5), e13001.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!