Axyprep multisource total rna kit

Total RNA was extracted from aortic tissues using the AxyPrep™ multisource total RNA kit (Axygen Scientific Inc.). RNA was reverse transcribed to cDNA using the TransScript All-in-One First-Strand cDNA Synthesis SuperMix (Transgen Biotech Inc., Beijing, China). Real-time quantitative RT-PCR analysis was carried out using the TransStart Top Green qPCR SuperMix (Transgen Biotech Inc., Beijing, China) and the ABI 7300 Real-Time qPCR System. The primers of CTGF, TGF-β1, MCP-1, TNF-α, HO-1, SOD-1, and Nrf2 were synthesized by Sangon Biotech (Shanghai, China), and the sequences are listed in Table 1. Data were expressed as number of fold increase compared with levels measured in controls by using the ΔΔ^Ct method and β-actin as a reference gene.

Total RNA was extracted from heart tissues using the AxyPrep™ multisource total RNA kit (Axygen Scientific, Inc). Then RNA was reverse transcribed to cDNA using the TransScript All‐in‐One first‐strand cDNA synthesis SuperMix (Transgen Biotech, Inc, Beijing, China). Real‐time PCR was performed using the TransStart Top Green qPCR SuperMix (Transgen Biotech, Inc, Beijing, China) and analysed by the ABI 7300 Real‐Time qPCR system. The primers of SIRT3 were purchased from Sangon Biotech (Shanghai, China), and the sequences were as follows: forward, 5′‐CGGCTCTACACGCAGAACATC‐3′ and reverse, 5′‐CAGCGGCTCCCCAAAGAA CAC‐3′.

Total RNA from lung tissues and RAW 264.7 cells were extracted using AxyPrep Multisource Total RNA kit (AXYGEN, USA). RNA was transcribed to cDNA using first strand cDNA synthesis kit (Novoprotein, Shanghai, China). The gene transcripts were detected using Novostart SYBER qPCR SuperMix Plus (Novoprotein, Shanghai, China) with a 7300 plus real-time PCR system (Applied Biosystems, USA) according to the manufacturer’s protocols. GAPDH was used as the internal reference. The sequences of primers were used as follows: mouse GAPDH forward: 5′- AGGTCGGTGTGAACGGATTTG-3′, reverse: 5′-CGCCACGAGCAGGAATGAGAAG-3′; mouse TNF-α forward: 5′-GCATGATCCGAGATGTGGAACTGG-3′, reverse: 5′-CGCCACGAGCAGGAATGAGAAG-3′; mouse IL-6 forward: 5′-AATTTCCTCTGGTCTTCTGGAGT-3′, reverse: 5′- GTGACTCCAGCTTATCTCTTGGT-3′; mouse IL-1β forward: 5′-GCAGAGCACAAGCCTGTCTTCC-3′, reverse: 5′-ACCTGTCTTGGCCGAGGACTAAG-3′; mouse IL-10 forward: 5′-TTCTTTCAAACAAAGGACCAGC-3′, reverse: 5′- GCAACCCAAGTAACCCTTAAAG-3′; mouse iNOS forward: 5′- ACTCAGCCAAGCCCTCACCTAC-3′, reverse: 5′-TCCAATCTCTGCCTATCCGTCTCG-3′; mouse CD86 forward: 5′- ACGGAGTCAATGAAGATTTCCT-3′, reverse: 5′- GATTCGGCTTCTTGTGACATAC; mouse Arg1 forward: 5′- CAGAAGAATGGAAGAGTCAG-3′, reverse: 5′-CAGAAGAATGGAAGAGTCAG-3′; mouse CD206 forward: 5′- CCTATGAAAATTGGGCTTACGG-3′, reverse: 5′-CTGACAAATCCAGTTGTTGAGG-3′. The relative mRNA level was calculated by 2^−ΔΔCt method.