Log In Sign up
The largest database of trusted experimental protocols

Anti cofilin

Manufactured by Abcam
Visit Supplier
Sourced in United States

Anti-cofilin is a laboratory product that functions as an antibody. It is used in research applications to detect and study the cofilin protein, which plays a role in regulating the dynamics of actin filaments within cells.

Automatically generated - may contain errors

Lab products found in correlation

Lipofectamine 3000, by Thermo Fisher Scientific (4 mentions) Anti fibronectin, by Abcam (2 mentions) Anti gapdh, by Cell Signaling Technology (2 mentions) Anti lamin b1, by Abcam (2 mentions) Anti rabbit hrp, by Jackson ImmunoResearch (2 mentions) Anti psyk y525 526, by Cell Signaling Technology (2 mentions) Anti mouse hrp, by Jackson ImmunoResearch (2 mentions) Anti syk, by Abcam (2 mentions) Anti pcttn y421, by Merck Group (2 mentions) Pspcas9n bb 2a puro px462 crispr cas9 vector, by Addgene (2 mentions) Anti cortactin, by Cell Signaling Technology (2 mentions) Anti gfp, by Takara Bio (2 mentions) Anti gapdh, by Merck Group (2 mentions) Phalloidin, by Thermo Fisher Scientific (2 mentions) Anti mecp2, by Cell Signaling Technology (2 mentions) Gradient page gels, by Bio-Rad (2 mentions) Anti n terminal rna polymerase 2 a 10, by Santa Cruz Biotechnology (2 mentions) Anti erk, by Cell Signaling Technology (2 mentions) Anti actinin, by Abcam (2 mentions) Anti hnrnpa1, by Cell Signaling Technology (2 mentions)

12 protocols using anti cofilin

1

Protein Analysis by Western Blotting

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were harvested in RIPA buffer (150 mM sodium chloride, 1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 50 mM Tris–HCl, pH7.5 and 2 mM EDTA) with 1% protease and phosphatase inhibitor cocktails (Sigma). Equal amount of proteins were separated by SDS/PAGE and analysed by immunoblotting. Western blotting was prepared by standard procedures using anti-YAP1 (Santa Cruz clone H-9, Cat. No.sc-271134), phospho-YAP1 (Ser127; Cell Signaling Technology, Cat. No. 4911), anti-TAZ (BD Pharmingen clone M2-616), anti-cofilin (Abcam, Cat. No. ab42824), anti-cofilin (phospho-S3; Abcam, Cat. No. ab12866), anti-gelsolin (Santa Cruz ABS017, Cat. No. sc-57509), anti-phospho-p44/42 MAPK (phospho-ERK1/2, Thr202/Tyr204; Cell Signaling Technology, Cat. No. 9101), anti-p44/42 MAPK (ERK1/2; Cell Signaling Technology, Cat. No. 9102), anti-FAK (Cell Signaling Technology, Cat. No. 3285), anti-phospho-FAK (Tyr397; Cell Signaling Technology, Cat. No. 3283) and β-actin (Santa Cruz clone C4, Cat. No.sc-271134) antibodies. The original scans of the blots are shown in Supplementary Fig. 11.
Lee H.J., Diaz M.F., Price K.M., Ozuna J.A., Zhang S., Sevick-Muraca E.M., Hagan J.P, & Wenzel P.L. (2017). Fluid shear stress activates YAP1 to promote cancer cell motility. Nature Communications, 8, 14122.
+ Open protocol
+ Expand
2

Western Blot Analysis of Cytoskeletal Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols
Western-blot analysis was performed as previously described [17 (link), 18 (link), 22 , 23 (link)]. The following primary antibodies were used: anti-ROCK1 (1:2,000, Cell-Signaling-Technology, USA), anti-phospho-LIMK2 (phospho-T505) (1:1,000, Abcam), anti-LIMK2 (1:2,000, Abcam), anti-phospho-Cofilin (1:500, Abcam), anti-Cofilin (1:1,000, Abcam), anti-Collagen-1 (1:2,000, Abcam) and anti-Fibronectin (1:2,000, Abcam). Results were quantified by densitometry and normalized to β-actin expression.
Park J., Son H., Chai J.S., Kim S.W., Paick J.S, & Cho M.C. (2019). Chronic administration of LIMK2 inhibitors alleviates cavernosal veno-occlusive dysfunction through suppression of cavernosal fibrosis in a rat model of erectile dysfunction after cavernosal nerve injury. PLoS ONE, 14(3), e0213586.
+ Open protocol
+ Expand
3

Kidney Protein Profiling Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
For each kidney sample total protein was isolated using RIPA buffer (25 mM Tris-HCl pH 7.6, 150 mM NaCl, 1% NP-40, 1% sodium deoxycholate, 0.1% SDS) and global protein was measurement by BCA™ Protein Assay Kit (Pierce, EUA). Around 50 μg of tissue protein was utilized for SDS-PAGE electrophoresis on 12.5% polyacrylamide gels. The immunostaining was performed with primary antibodies (Anti-Cofilin/1:1,000, Abcam, USA, Anti-PPAR-α/1:300, Abcam, Anti-CPT1A/1:1,000, Abcam, Anti-CPT-2/1:500, Abcam and Anti-Beta Actin/1:5,000, Cell Signaling, USA), followed by conjugated secondary antibodies (anti-mouse or anti-rabbit peroxidase/1:250.000, Sigma, USA). After, the nitrocellulose membrane was revealed by chemiluminescence methods using the ECL kit (Millipore, USA), and the images were acquired on Amersham Imager 600 equipment (GE Healthcare, UK). The SyncMaster 740 n software device (GE Healthcare, UK) were used to analyze and quantify the gel bands. The experiment was reapeated twice.
Estrela G.R., Wasinski F., Batista R.O., Hiyane M.I., Felizardo R.J., Cunha F., de Almeida D.C., Malheiros D.M., Câmara N.O., Barros C.C., Bader M, & Araujo R.C. (2017). Caloric Restriction Is More Efficient than Physical Exercise to Protect from Cisplatin Nephrotoxicity via PPAR-Alpha Activation. Frontiers in Physiology, 8, 116.
+ Open protocol
+ Expand
4

Quantitative Western Blot Analysis of Mouse Brain Proteins

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
Whole and synaptosomal lysates of the mouse brains were prepared as described previously (Han et al., 2009 (link); Jin et al., 2019a (link),b (link)). The antibodies used for Western blot analysis were anti-Cofilin (1:1,000, Abcam, AB42824), anti-CYFIP1 (1:1,000, Millipore, AB6046), anti-CYFIP2 (1:3,000, Abcam, AB95969), anti-GABA-A-R-β2/3 (1:1,000, NeuroMab, 75-363), anti-GAPDH (1:3,000, Cell Signaling, #2118), anti-Gephyrin (1:500, Synaptic Systems, 147-011), anti-GluA1 (1:2,000, Millipore, 04-855), anti-GluA2 (1:1,500, Millipore, MAB397), anti-GluN1 (1:1,000, Millipore, MAB363), anti-Homer1b/c (1:1,000, Synaptic Systems, 160-002), anti-Neuroligin-3 (1:1,000, NeuroMab, 75-158), anti-PSD-95 (1:2,000, Thermo Fisher Scientific, MA1-046), and anti-WAVE1 (1:1,000, NeuroMab, 75-048). Western blot images were acquired using a ChemiDoc Touch Imaging System (Bio-Rad) and quantified using ImageJ software.
Zhang Y., Kang Hyae R., Lee S.H., Kim Y., Ma R., Jin C., Lim J.E., Kim S., Kang Y., Kang H., Kim S.Y., Kwon S.K., Choi S.Y, & Han K. (2020). Enhanced Prefrontal Neuronal Activity and Social Dominance Behavior in Postnatal Forebrain Excitatory Neuron-Specific Cyfip2 Knock-Out Mice. Frontiers in Molecular Neuroscience, 13, 574947.
+ Open protocol
+ Expand
5

Western Blot Protein Expression Analysis

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
The total cell protein extracts were prepared as described elsewhere [44 (link)]. Polyvinylidene difluoride (PVDF) membrane was incubated with the primary antibody anti-cofilin (1:200), anti-fibronectin (1:400), anti-α-tubulin (1:500), anti-TRF1 (1:1000), anti-TRF2 (1:3000), anti-RRN3 (1:3000), anti-lamin B1 (1:1000), anti-DNMT2 (1:500), anti-p21 (1:100) or anti-β-actin (1:1000) (Abcam, Novus Biologicals, Santa Cruz Technology) and the secondary antibodies conjugated to HRP (1:80000, Sigma-Aldrich). The respective proteins were detected using a Clarity™ Western ECL Blotting Substrate (BioRad, Warsaw, Poland) and a G:BOX imaging system (Syngene, Cambridge, UK) according to the manufacturer's instructions. Densitometry measurements of the bands were performed using GelQuantNET software (http://biochemlabsolutions.com/GelQuantNET.html). The data represent the relative density normalized to β-actin.
Lewinska A., Klukowska-Rötzler J., Deregowska A., Adamczyk-Grochala J, & Wnuk M. (2019). c-Myc activation promotes cofilin-mediated F-actin cytoskeleton remodeling and telomere homeostasis as a response to oxidant-based DNA damage in medulloblastoma cells. Redox Biology, 24, 101163.
+ Open protocol
+ Expand
6

SYK Knockout in OVISE Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Equal amounts of protein preparations (15–30 μg of total cell lysate, and cytosolic, nuclear, and/or other fractions) were resolved on SDS-PAGE. The antibodies used include: anti-SYK (Abcam, Cambridge, United Kingdom, #ab3113), anti-pCTTN (Y421) (Millipore, #AB3852), anti-cortactin (Cell Signaling Technology, #3503), anti-pSYK (Y525/526) (Cell Signaling Technology, #2710), anti-cofilin (Abcam, #ab11062), anti-GFP (Clontech, #632375), anti-GAPDH (Sigma-Aldrich, St, Louis, MO, USA, #G9545), anti-mouse HRP (Jackson Immuno Research, West Grove, PA, USA, #715-035-150), and anti-rabbit HRP (Jackson Immuno Research, #711-035-152). GAPDH was used as a loading control. The pSpCas9n(BB)-2A-Puro (PX462) CRISPR/Cas9 vector from Addgene (plasmid no. 48141) was used in this study. Cloning was performed using a pair of CRISPR single-guide RNA (sgRNA) specifically targeting exon 2 of SYK; top strand-nicking sgRNA (CGGACAGGGCGAAGCCACCC) and bottom strand-nicking sgRNA (CACACCACTACACCATCGAG) were designed and cloned as previously described.49 (link) OVISE cells were transfected using Lipofectamine® 3000 (Thermo Fisher Scientific), and positive cells were selected in the presence of 2 μg/ml puromycin. Single cell clones were isolated and screened for Cas9 expression. The SYK knock-out was verified by immunoblotting. Early passage (less than 3) knockout cells were used for experiments.
Yu Y., Rahmanto Y.S., Lee M.H., Wu P.H., Phillip J.M., Huang C.H., Vitolo M.I., Gaillard S., Martin S.S., Wirtz D., Shih I.M, & Wang T.L. (2018). Inhibition of ovarian tumor cell invasiveness by targeting SYK in tyrosine kinase signaling pathway. Oncogene, 37(28), 3778-3789.
+ Open protocol
+ Expand
7

Immunostaining Cochlear Sensory Epithelia

Check if the same lab product or an alternative is used in the 5 most similar protocols
The cochleae were placed in the medium containing 3 mM FM1-43 (Thermo Fisher, F35355) for 90 s and washed three times in PBS (pH 7.2). The cochleae then were dissected and fixed with 4% polyoxymethylene for 1 h and permeabilized with 0.5% Triton X-100 for 1 hour. The sensory epithelia were then incubated with the following primary antibodies overnight at 4 °C: anti-LIMK1 (Santa Cruz, sc-8387); anti-LIMK2 (Santa Cruz, sc-5577); anti-MYO7A (Proteus Bioscience, 25-6790); anti-SOX2 (Santa Cruz, sc-17320, sc-365823); anti-CtBP2 (C-terminal-binding protein 2), anti-IgG1 (BD Biosciences, 612044), anti-PSD95 IgG2a (Millipore, MAB1596), anti-cofilin (Abcam, ab42824), anti p-cofilin (Santa Cruz, sc-12912), and anti-prestin (Santa Cruz, sc-22692). Phalloidin (Invitrogen, A34055) was used to stain the actin cytoskeleton, and DAPI was used to label the nuclei. The tissues were washed three times with PBST (0.1 M phosphate buffer, pH 7.2, with 0.1% Triton X-100) and incubated for 1 h (37 °C) with DAPI (Sigma-Aldrich, D9542) and suitable secondary antibody (Abcam: ab150075, ab150105, ab150074, ab150073, ab150107; Invitrogen: A21131, A21124). Finally, the sensory epithelia were mounted on glass slides with Fluoromount-G mounting medium. Images were taken using a Zeiss LSM700 confocal microscope.
Fang Q., Zhang Y., Da P., Shao B., Pan H., He Z., Cheng C., Li D., Guo J., Wu X., Guan M., Liao M., Zhang Y., Sha S., Zhou Z., Wang J., Wang T., Su K., Chai R, & Chen F. (2019). Deletion of Limk1 and Limk2 in mice does not alter cochlear development or auditory function. Scientific Reports, 9, 3357.
+ Open protocol
+ Expand
8

SYK Knockout in OVISE Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Equal amounts of protein preparations (15–30 μg of total cell lysate, and cytosolic, nuclear, and/or other fractions) were resolved on SDS-PAGE. The antibodies used include: anti-SYK (Abcam, Cambridge, United Kingdom, #ab3113), anti-pCTTN (Y421) (Millipore, #AB3852), anti-cortactin (Cell Signaling Technology, #3503), anti-pSYK (Y525/526) (Cell Signaling Technology, #2710), anti-cofilin (Abcam, #ab11062), anti-GFP (Clontech, #632375), anti-GAPDH (Sigma-Aldrich, St, Louis, MO, USA, #G9545), anti-mouse HRP (Jackson Immuno Research, West Grove, PA, USA, #715-035-150), and anti-rabbit HRP (Jackson Immuno Research, #711-035-152). GAPDH was used as a loading control. The pSpCas9n(BB)-2A-Puro (PX462) CRISPR/Cas9 vector from Addgene (plasmid no. 48141) was used in this study. Cloning was performed using a pair of CRISPR single-guide RNA (sgRNA) specifically targeting exon 2 of SYK; top strand-nicking sgRNA (CGGACAGGGCGAAGCCACCC) and bottom strand-nicking sgRNA (CACACCACTACACCATCGAG) were designed and cloned as previously described.49 (link) OVISE cells were transfected using Lipofectamine® 3000 (Thermo Fisher Scientific), and positive cells were selected in the presence of 2 μg/ml puromycin. Single cell clones were isolated and screened for Cas9 expression. The SYK knock-out was verified by immunoblotting. Early passage (less than 3) knockout cells were used for experiments.
Yu Y., Rahmanto Y.S., Lee M.H., Wu P.H., Phillip J.M., Huang C.H., Vitolo M.I., Gaillard S., Martin S.S., Wirtz D., Shih I.M, & Wang T.L. (2018). Inhibition of ovarian tumor cell invasiveness by targeting SYK in tyrosine kinase signaling pathway. Oncogene, 37(28), 3778-3789.
+ Open protocol
+ Expand
9

Comprehensive Protein Analysis by Western Blot

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total proteins were separated by electrophoresis on 4–20% gradient PAGE gels (Bio‐Rad, 4561093) and transferred onto nitrocellulose membrane. The following antibodies were used: anti‐phosphoAKT (Ser473) (Cell Signaling, 9271S), anti‐AKT (Cell Signaling, 9272S), anti‐phosphoCREB (Ser133) (Millipore, aa77‐343), anti‐phosphoERK (Cell signaling, 4370S), anti‐ERK (Cell signaling, 4695S), anti‐phospho‐CTD RNA polymerase II (Ser2) (Abcam, ab5095), anti‐CTD RNA polymerase II (Abcam, ab817), anti‐N‐terminal RNA polymerase II A‐10 (Santa Cruz, sc17798), anti‐ACTININ (Abcam, ab68194), anti‐COFILIN (Abcam, ab54532), anti‐GAPDH (clone D16H11, Cell Signaling, 5174), anti‐MECP2 (Cell Signaling, 3456), anti‐U1‐70K (clone H111, Synaptic Systems, 203011), anti‐LAMIN B1 (Abcam, ab133741), anti‐hnRNPA1 (clone D21H11, Cell Signaling, 8443), and anti‐betaIII TUBULIN (Abcam, ab18207).
Mazille M., Buczak K., Scheiffele P, & Mauger O. (2022). Stimulus‐specific remodeling of the neuronal transcriptome through nuclear intron‐retaining transcripts. The EMBO Journal, 41(21), e110192.
+ Open protocol
+ Expand
10

Immunostaining of Phospho-cofilin in PC12 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Differentiated PC12 neuronal cells were fixed using 4% paraformaldehyde and treated with 0.3% of Triton X-100. Primary antibodies – rabbit anti-phosphocofilin, anti-cofilin (1:100; Abcam, Cambridge, MA, USA) were incubated overnight at 4°C. Texas red labeled donkey anti-rabbit secondary IgG antibody (1:400; Jackson ImmunoResearch, West Grove, PA, USA) was used at room temperature for 1 h. Staining of F-actin in the cells was carried out using one unit of phalloidin (Invitrogen, Carlsbad, CA, USA). After rinsing with PBS, the coverslip was mounted with DAPI (Santa Cruz Biotechnology, Santa Cruz, CA, USA) over the glass slide and the gap was sealed.
Madineni A., Alhadidi Q, & Shah Z.A. (2014). Cofilin inhibition restores neuronal cell death in oxygen glucose deprivation model of ischemia. Molecular neurobiology, 53(2), 867-878.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!