Omniscript rt pcr system

Three fragments of the promoter region of EDS5H were amplified using the High Fidelity Kit (Roche) with gene-specific primers designed to introduce EcoRI at the 5’ ends and NcoI sites at the 3’ ends of the fragments. The forward primers used for the amplification of EDS5H promoter fragments were: Pro500F, Pro1000F and Pro2000F resulting in fragments of 546 bp, 1057 and 1984 bp, respectively. The reverse primer for the EDS5H promoter fragments was ProE5H-R. The PCR fragments were cloned into the plasmid pCAMBIA 1303 (www.CAMBIA.org) from which the fragments of the promoter CaMV 35S and LacZ alpha had been removed.
The ORF of EDS5H was amplified by High-fidelity RT-PCR using the Omniscript RT-PCR system (Qiagen) and the forward primer Nco-E5H introducing a NcoI site as well the reverse primer E5H-Mycs introducing a triple cMyc-tag and the restriction sites SmaI and NdeI. The PCR fragment was cloned into pGEM-T Easy Vector (Promega) in the NcoI and NdeI sites. The clone was sequenced and the NcoI-SmaI fragment that included EDS5H::3xcMyc-tagg was then cloned into pCAMBIA 1304 (www.CAMBIA.org) from which the GUS and GFP genes had been removed.

Total RNA from tissue samples was isolated by phenol chloroform using the TRIzol reagent (Invitrogen, Burlington, ON, Canada) as recommended by the manufacturer, and reverse transcription was performed with an Omniscript RT-PCR system (Qiagen, Mississauga, ON, Canada). The mRNA levels of selected genes were measured by real-time PCR with a Rotor-Gene 3000 real-time DNA detection system (Montreal Biotech, Kirkland, QC, Canada) and QuantiTect SYBR Green I PCR kits (Qiagen, Mississauga, ON, Canada) as previously described [33 (link)]. Expression levels were normalized to the housekeeping gene β-actin. The following primers were used: Hamp (F) CCTATCTCCATCAACAGATG; Hamp(R) AACAGATACCACACTGGGAA; β-actin (F) TGTTACCAACTGGGACGACA; β-actin (R) GGTGTTGAAGGTCTCAAA.