All animal procedures were approved by the Institutional Animal Care and Use Committee at the Danyang People's Hospital of Jiangsu Province. Moderate tSCI was induced using the weight drop device as reported previously [20 (link)–22 (link)]. Adult female Sprague-Dawley rats (200–250 g) were obtained from Slaccas Laboratory Animal, (Shanghai, China). To create a contusive tSCI, the rats received ketamine (0.25 mL/kg, 100 mg/mL). The laminectomy was performed to expose the spinal cord at T8, and a moderate tSCI was created using a weight-drop device, with a 10 g weight dropped 2.5 cm. Rats were acclimatized for at least 7 days prior to the operation and were bred in standard cages on a 12 h light/dark cycle with free access to food and water. The preconditioning of sevoflurane was applied according to the previous study [5 (link)]. NS-398 (Selleck, S8433, USA) was dissolved in 0.5 mL of 1:1 (v/v) DMSO/saline such that the final dose delivered was 5 mg/kg NS-398 intraperitoneally [16 (link)]. For interfering with the expression of Cav-3 in injured spinal cord tissues via adenovirus delivery system, two shRNAs targeting the CDS of Cav-3 mRNA were designed (shCav-3#1: GACCGAAGAGCACACAGATCT; shCav-3#2: GGGTGAGCTACACCACTTTCA) and cloned to pAd-hU6-CMV-puromycin cloning vector. A scramble shRNA (shCtrl: CCTAAGGTTAAGTCGCCCTCG) was also designed as a control.
Ns398
Manufactured by Selleck Chemicals
Sourced in United States
NS398 is a selective COX-2 inhibitor. It is a white crystalline powder that is soluble in DMSO and alcohol. The core function of NS398 is to selectively inhibit the COX-2 enzyme.
Automatically generated - may contain errors
Lab products found in correlation
Sb202190, by Selleck Chemicals (2 mentions)
Sch772984, by Selleck Chemicals (2 mentions)
Antibodies against cox 2, by Cell Signaling Technology (1 mentions)
Epcam, by Cell Signaling Technology (1 mentions)
Anti gapdh antibody, by Beyotime (1 mentions)
Phospho jnk, by Cell Signaling Technology (1 mentions)
Phospho erk, by Cell Signaling Technology (1 mentions)
Ly294002, by Selleck Chemicals (1 mentions)
U0126, by Selleck Chemicals (1 mentions)
Sp600125, by Selleck Chemicals (1 mentions)
Phospho akt, by Cell Signaling Technology (1 mentions)
Jsh 23, by Selleck Chemicals (1 mentions)
N acetyl cysteine (nac), by Apexbio (1 mentions)
Tak 242, by Apexbio (1 mentions)
Dulbecco s modified eagle s medium nutrient mixture f 12, by Thermo Fisher Scientific (1 mentions)
Foetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
Dimethyl sulfoxide (dmso), by Avantor (1 mentions)
L nmma, by Merck Group (1 mentions)
Anti cd3 cd28 beads, by Thermo Fisher Scientific (1 mentions)
Rpmi 1640, by Sartorius (1 mentions)
7 protocols using ns398
1
Contusive Spinal Cord Injury Model in Rats
2
Detailed Characterization of Airborne PM
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The standard reference airborne PM (standard reference material 1649b), mainly composed of polycyclic aromatic hydrocarbons, polychlorinated biphenyl congeners, pesticides, and doxins, was purchased from the National Institute of Standards and Technology (Gaithersburg, MD, USA). The specific molecular inhibitors SP600125, U0126, LY294002, AH6809, and NS398 were purchased from Selleck (Houston, TX, USA). Antibodies against COX-2, phospho-ERK, ERK, phospho-JNK, JNK, phospho-AKT, AKT, and EpCAM were purchased from Cell Signaling Technology (Danvers, MA, USA). Anti-Filaggrin antibody was obtained from GeneTex (San Antonio, TX, USA) and anti-GAPDH antibody was purchased from Beyotime (Shanghai, China). mRNA primers were synthesized by Sangon Biotech (Shanghai, China). The reagents for real-time qPCR were purchased from TaKaRa Bio (Shiga, Japan). The reagents used for western blotting were obtained from Solarbio Life Science (Beijing, China).
3
Inhibition of Giardia Pathways
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
COX-2 inhibitor NS398 (50 μM, final concentration), p38 inhibitor SB202190 (10 μM), ERK1/2 inhibitor SCH772984 (10 μM), and NF-κB inhibitor JSH-23 (50 μM) (Selleckchem, Houston, USA), as well as ROS inhibitor NAC (10 μM; APEXBIO, Houston, USA) were used to inhibit target proteins in this study. All inhibitors were applied 1 h prior to Giardia exposure.
4
Inhibition of MAPK Signaling Pathways
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
COX-2 inhibitor NS398 (50 μM), p38 MAPK inhibitor SB202190 (FHPI) (10 μM), and ERK1/2 MAPK inhibitor SCH772984 (10 μM), was purchased from Selleck Chemicals (Houston, United States). TLR4 inhibitor TAK-242 (10 μM) was purchased from APEXBIO Technology (Houston, United States). Cells were separately pretreated with these drugs at the indicated concentrations for 1 h at 37°C. At the time of the second addition of gentamicin, the inhibitors were also added, and the point was defined as time 0. Cells treated with TAK-242 were collected at 1 h after infection to detect the protein level of phosphorylated and unphosphorylated ERK1/2 MAPK and p38 MAPK, and at 6 h after infection to determine the COX-2 expression level. ERK1/2 inhibitor SCH772984 and p38 MAPK inhibitor SB202190 (FHPI) treated cells were collected at 6 h after infection to detect COX-2 expression level. NS398 treated cells were collected at 6 h and 9 h after infection to detect reactive oxygen species (ROS), cell death, and cytokine expression levels. NS398 treated cells were collected at 6 h after infection to investigate the LC3 expression level. These experiments were performed in triplicate with three biological repetitions.
5
BALB/c Mice Infection Model
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Specific pathogen-free six-week-old male and female BALB/c mice were purchased from the Comparative Medicine Center of YangZhou University and housed in specific pathogen-free conditions. To rule out the effect of gender, equal numbers of male and female mice were used in this study. For the infection challenge, mice were inoculated by intraperitoneal injection with 1 × 106 CFU of bacteria resuspended in 100 μL sterile phosphate buffered saline (PBS). NS398 (Selleck, 15 mg/kg) inhibitor or DMSO vehicle treatment were administered at 4 h prior to and 4 and 8 h after inoculation. Mice received 100 μL NS398 dissolved in DMSO or DMSO vehicle by intraperitoneal injection. In the survival experiment, mice were observed for 72 h for signs of morbidity and mortality. Mice were euthanized the nearing endpoint. Euthanasia endpoints used in this study included loss of 20% body weight, hunched posture, and decreased movement, or response to stimuli, or paralysis. In bacterial load assessment assay, the blood, liver, lung, spleen, brain, and kidney of mice were collected at 24 h post infection, and bacterial numbers were evaluated by plating 10-fold serial dilutions of blood, liver, lung, spleen, brain, and kidney homogenates on MacConkey Agar.
6
ADPKD Cyst-Lining Epithelial Cell Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ADPKD cyst‐lining epithelial mouse cells (herein, Pkd1−/− cells) were a kind gift from Yiqiang Cai (Yale University School of Medicine) and cultured as described by Shibazaki et al.23 The human renal clear‐cell adenocarcinoma cell line 786‐0 was purchased from Shanghai Institute of Cell Biology and grown in Dulbecco's modified Eagle's medium/Nutrient Mixture F‐12 (Gibco/Life Technologies) supplemented with 10% foetal bovine serum (Gibco/Life Technologies) at 37°C. NS398 was purchased from Selleck and dissolved in dimethylsulfoxide (DMSO; Amresco) to prepare a stock solution. Both cells were treated with NS398 at 50 or 100 μM for 24 or 48 h, respectively. The control group was administered the same volume of DMSO.
7
T Cell Suppression Assay with Myeloid Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
T cells from GPBSC were purified by positive selection using CD3 cell isolation via flow cytometry. Purified CD3+ T lymphocytes were labeled with 5 μM 5,6-carboxy-fluorescein diacetate succinimidyl ester (CFSE) (eBioscience) and thereafter were co-cultured with isolated HLA-DR−/lowCD33+CD16− at a HLA-DR−/lowCD33+CD16− to CD3+ T cell ratio of 0.25:1 to 2:1 in the presence of anti-CD3/CD28 beads (Thermo) in RPMI 1640 (Biological Industries) supplemented with 10% FBS, penicillin/streptomycin, and 2 mM l -glutamine. 105 T cells were seeded in 96-well U-bottom plates. After 4 days, cells were harvested for flow cytometry analysis. To neutralize IL-10 and TGF-β, blocking antibodies were used at 10 to 20 μg/ml concentrations (blocking antibody for IL-10 and TGF-β from R&D Systems). To inhibit arginase activity, nor-NOHA (Calbiochem) was used at a concentration of 300 μM. For the inhibition of iNOS, l -NMMA (Sigma) was used at a concentration of 300 μM. To inhibit IDO, indoximod (NLG8189) (Selleck) was used at a concentration of 500 μM. To inhibit Cox2, NS398 (Selleck) was used at a concentration of 10 μM. All the in vitro experiment was repeated at least three times.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!