All in one qpcr mix

Manufactured by GeneCopoeia

Sourced in United States, China

The All-in-One qPCR Mix is a ready-to-use solution for quantitative real-time PCR (qPCR) reactions. It contains all the necessary components, including a proprietary DNA polymerase, buffer, and dNTPs, to perform qPCR experiments. The mix is designed to provide reliable and consistent results.

Automatically generated - may contain errors

Lab products found in correlation

113 protocols using all in one qpcr mix

Sugarcane GAPDH Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Sugarcane GAPDH (glyceraldehyde-3-phosphate dehydrogenase) was selected as the reference gene. Among the DEGs screened, 10 that were involved in ethylene or ABA metabolic pathways were randomly selected, and specific primers were designed (Supplementary Table 1). The transcriptome RNA from related root samples was extracted and converted into cDNA, and gene expression was confirmed using quantitative real-time PCR (qRT-PCR). The reaction condition is as follows: 10 μL 2 × All-in-One qPCR Mix (Gene Copoeia, Rockville, MD, United States), 2 μL cDNA, and 1 μL each of the 4 μM primers and ddH₂O up to 20 μL. The reaction proceeds as follows: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 10 s, annealing at 60°C for 20 s, extension at 72°C for 20 s of 40 cycles. Relative expression quantification of the selected DEGs to control GAPDH was analyzed using the 2^–ΔΔCt method (Livak and Schmittgen, 2001 (link)).

Nong Q., Malviya M.K., Solanki M.K., Solanki A.C., Lin L., Xie J., Mo Z., Wang Z., Song X.P., Huang X., Rai S., Li C, & Li Y.R. (2022). Sugarcane Root Transcriptome Analysis Revealed the Role of Plant Hormones in the Colonization of an Endophytic Diazotroph. Frontiers in Microbiology, 13, 924283.

+ Open protocol

+ Expand

Quantitative PCR Analysis of Pluripotency Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

The qPCR amplification was done in a 20-uL reaction mixture containing 100 ng of cDNA, 10 uL 2× All-in-One™ qPCR mix (GeneCopoeia, Rockville, MD, USA), 0.3 mM of upstream and downstream primers, and nuclear-free water. The PCR reaction was conducted with 1 cycle at 95 °C for 10 min, 40 cycles at 95 °C for 15 s, 40 °C for 30 s, and 60 °C for 1 min, followed by dissociation curve analysis distinguishing PCR products. The expression level of a gene was normalized with the endogenous control gene β-actin. The relative expressions of genes were calculated using the 2-ΔΔCT method, normalized by β-actin and presented as mean ± SD (n = 3) (Fig. 6a). The sequences of the paired sense and antisense primers for human SOX2, NANOG, OCT4, c-MYC, KLF4, and β-actin are listed in Additional file 1: Table S5.

Xu Y., Zhao W., Olson S.D., Prabhakara K.S, & Zhou X. (2018). Alternative splicing links histone modifications to stem cell fate decision. Genome Biology, 19, 133.

+ Open protocol

+ Expand

Quantification of mRNA and miRNA in HUVEC-derived EVs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNAs from HUVECs were isolated using the Trizol reagent (Invitrogen) and reverse transcribed into complementary DNA using the HiScript III RT SuperMix for qPCR (R302-01, Vazyme, Nanjing, China) following the manufacturer’s description. MiRNAs was extracted from the M-EVs and N-EVs using a mirVana RNA isolation kit (Ambion, Austin, TX), synthesis of cDNA and qRT-PCR were performed using All-in-One miRNA qRT-PCR Detection Kit (GeneCopoeia, Rockville, MD, USA) following the manufacturer’s protocol. Then, quantitative PCR was performed using ChamQ SYBR qPCR Master Mix (Low ROX Premixed) (Q331-02, Vazyme, Nanjing, China) for mRNA and 2 × All-in-One qPCR Mix (GeneCopoeia) for miRNA based on LightCycler96 PCR system (Roche, Inc., Switzerland). The primers for real-time PCR (miR-210-3p, miR-210-3p, miR-708-3p, miR-301a-5p, miR-491-5p, miR-301b-3p, miR-4485-3p, miR-548, miR-1-3p, miR-2355-3p and U6) all were purchased from GeneCopoeia. The relative expression of mRNA and miRNA was evaluated by the 2^−ΔΔCt method. The mRNA quantification of qPCR was normalized to GAPDH expression and miRNA quantification was normalized to U6.

Pu Y., Li C., Qi X., Xu R., Dong L., Jiang Y., Gong Q., Wang D., Cheng R., Zhang C, & Chen Y. (2023). Extracellular Vesicles from NMN Preconditioned Mesenchymal Stem Cells Ameliorated Myocardial Infarction via miR-210-3p Promoted Angiogenesis. Stem Cell Reviews and Reports, 19(4), 1051-1066.

+ Open protocol

+ Expand

Quantitative PCR Analysis of Gli1 and Ptch1 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from RCTE or Inpp5e^+/− MEF cells using the TRIzol reagent (Invitrogen, #15596-026). cDNA was generated using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, #00351115). Quantitative PCR was performed using the 2× All-in-One qPCR Mix (GeneCopoeia, #HmiRQP2641) on a CFX384 Real-Time system (Bio-Rad). Relative expression levels were calculated using the 2^−ΔΔCt method and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as reference gene. Forward and reverse primers are as follows: human/mouse GAPDH-forward, 5′-TCCTGCACCACCAACTGCTT-3′; human/mouse GAPDH-reverse, 5′-GTCTTCTGGGTGGCAGTGAT-3′; human Gli1-forward, 5′-CCATTCCAATGAGAAGCCGT-3′; human Gli1-reverse, 5′-GACCATGCACTGTCTTGACA-3′; mouse Gli1-forward, 5′-GGTGCTGCCTATAGCCAGTGTCCTC-3′; mouse Gli1-reverse, 5′-GTGCCAATCCGGTGGAGTCAGACCC-3′; mouse Ptch1-forward, 5′-CTCTGGAGCAGATTTCCAAGG-3′; and mouse Ptch1-reverse, 5′-TGCCGCAGTTCTTTTGAATG-3′.

Chen C., Xu Q., Zhang Y., Davies B.A., Huang Y., Katzmann D.J., Harris P.C., Hu J, & Ling K. (2021). Ciliopathy protein HYLS1 coordinates the biogenesis and signaling of primary cilia by activating the ciliary lipid kinase PIPKIγ. Science Advances, 7(26), eabe3401.

+ Open protocol

+ Expand

Tissue-Specific Gene Expression Analysis

Cited 3 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using the RNAprep pure Plant Kit (TIANGEN, DP432) and reverse transcription using the EvoM-MLV RT Kit with gDNA Clean for qPCR (Accurate Biology, AG11705). The quantitative real-time PCR (qPCR) was performed using the 2× All-in-one ™-qPCR Mix (Genecopoeia, Qp001-01). The specific primers were designed using Primer 3 Input software (version 4.1.0). The internal reference gene was TIP41 (Fan et al., 2013 (link)); primers are shown in the Supplementary Table S4. Expression patterns were analyzed by transcriptomic data and real-time quantitative PCR to synthetically screen candidate tissue-specific genes for in situ hybridization analysis (Wang et al., 2017 (link); Li et al., 2018a (link)). Gene expression heat mapping was performed using TBtools software (Chen et al., 2020 (link)).

Bai Y., Cai M., Mu C., Cheng W., Zheng H., Cheng Z., Li J., Mu S, & Gao J. (2022). New Insights Into the Local Auxin Biosynthesis and Its Effects on the Rapid Growth of Moso Bamboo (Phyllostachys edulis). Frontiers in Plant Science, 13, 858686.

+ Open protocol

+ Expand

Quantitative Analysis of mRNA and miRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNAs from human LF tissues, mouse LF tissues, and cultured mouse LF cells were isolated using the Trizol reagent (Invitrogen) and reverse transcribed into complementary DNA using the HiScript III RT SuperMix for quantitative PCR (qPCR; R302-01, Vazyme, Nanjing, China), following the manufacturer's description. For miRNA, cDNA and quantitative reverse transcription PCR (qRT-PCR) syntheses were performed using the All-in-One miRNA qRT-PCR Detection Kit (GeneCopoeia, Rockville, MD, USA), following the manufacturer's protocol. Next, qPCR was conducted using ChamQ SYBR qPCR Master Mix (Low ROX Premixed; Q331-02, Vazyme) for mRNA and 2 × All-in-One qPCR Mix (GeneCopoeia) for miRNA based on the LightCycler96 PCR system (Roche, Inc., Switzerland). The mRNA quantification of qPCR was normalised to GAPDH expression, and the miRNA quantification was normalised to U48 expression. The comparative 2^−△△CT method was used in the analysis. Table S3 presents a list of RT-qPCR primer sequences.

Ma C., Qi X., Wei Y.F., Li Z., Zhang H.L., Li H., Yu F.L., Pu Y.N., Huang Y.C, & Ren Y.X. (2022). Amelioration of ligamentum flavum hypertrophy using umbilical cord mesenchymal stromal cell-derived extracellular vesicles. Bioactive Materials, 19, 139-154.

+ Open protocol

+ Expand

Quantitative Analysis of mRNA and miRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total mRNAs were extracted from tissues and cells using ice-cold Biozol regent (Hangzhou Bori Technology Co., Ltd., China). The total RNA concentration and purity were measured with a spectrophotometer NanoDrop 2000 (Nanodrop Technologies, Wilmington, DE, USA). For single-step synthesis of miRNA cDNA, the poly(A) polymerase was used to add the poly(A) tails to the 3′ ends of the miRNAs, and the poly(A) miRNAs were reverse transcribed using M-MLV reverse transcriptase and unique oligo (dT) adapter primer. Then, the cDNAs were analyzed by quantitative real-time PCR using 2 × All-in-One qPCR Mix (GeneCopoeia, USA) with the CFX Manager software detection system (Bio-Rad, USA). For the first-strand cDNA synthesis of mRNA, PrimeScript RT reagent Kit (TAKARA, Japan) was used and quantitative RT-PCR was performed using SYBR FAST qPCR Master (KAPA, USA). All primers of miRNAs and RNU6A (u6) were purchased from GeneCopoeia Inc. (Rockville, MD, USA). Primer sequences were as follows: Mkp-1 (Forward primer: 5′-GTACATAAGTCCATCTGAC-3′, Reverse primer: 5′-GGTTCTTCTAGGAGTAGACA-3′); Gapdh (Forward primer: 5′-AACTGCTTAGCACCCCTGGC-3′, Reverse primer: 5′-ATGACCT TGCCCACAGCCTT-3′).

Luo M., Pang Y., Li J., Yi L., Wu B., Tian Q., He Y., Wang M., Xia L., He G., Song W., Du Y, & Dong Z. (2023). miR-429-3p mediates memory decline by targeting MKP-1 to reduce surface GluA1-containing AMPA receptors in a mouse model of Alzheimer's disease. Acta Pharmaceutica Sinica. B, 14(2), 635-652.

+ Open protocol

+ Expand

Corneal RNA Isolation and qPCR Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from the corneal tissue using the RNeasy kit (Qiagen, Germantown, MD, USA) following the manufacturer’s protocol. First-strand cDNA was synthesized by reverse transcriptase enzyme (Promega, Madison, WI, USA). Quantitative PCR (qPCR) was performed using the One Step Plus Real-Time PCR system (Applied Biosystems, Carlsbad, CA, USA). A 20 μl reaction mixture containing 2 μl cDNA, 2 μl forward and reverse primers (200 nM each), and 10 μl of 2X All-in-One qPCR mix (GeneCopoeia, Rockville, MD, USA) was run at a universal cycle (95 °C for 10 min, 40 cycles at 95 °C for 15 s, and 60 °C for 60 s) as previously reported (Mohan et al., 2011 (link); Tandon et al., 2013 (link)). Gene-specific forward and reverse primer sequences used in PCR analyses are summarized in Table 1. The GAPDH was used for the normalization of qPCR data and showed no detectable relative fold change at various tested points or groups. The relative gene expression was calculated by the 2^−ΔΔCt method and reported as relative fold-change over the respective control values. A minimum of three independent experiments were conducted, qPCR was performed in triplicate for each sample, and the average fold changes in mRNA levels were reported.

Tripathi R., Giuliano E.A., Gafen H.B., Gupta S., Martin L.M., Sinha P.R., Rodier J.T., Fink M.K., Hesemann N.P., Chaurasia S.S, & Mohan R.R. (2019). Is sex a biological variable in corneal wound healing?. Experimental eye research, 187, 107705.

+ Open protocol

+ Expand

Quantitative Analysis of BIM Expression

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated using Qiagen RNEasy. Synthesis of cDNA was carried out using the TaqMan™ Reverse Transcription Reagents Kit (Invitrogen™). Assays for BIM (Hs00708019_s1, Invitrogen™), GAPDH (Hs02758991_g1, Invitrogen™), and β-2 microglobulin (Hs00984230_m1, Invitrogen™) were performed according to the manufacturer’s instructions. Alternatively, qRT-PCR was performed using the following primers as previously described [21 (link)]: BIM-EL, forward 5′-GTG GGT ATT TCT CTT TTG ACA CAG AC-3′; BIM-L, forward, 5′-TAC AGA CAG AGC CAC AAG ACA G-3′; and common reverse primer, 5′-GTT CAG CCT GCC TCA TGG AAG-3′; and RPS17 Quantitect primers (QIAGEN). In this case, 2x-All-in-One™ qPCR mix (Genecopoeia) was used according to the manufacturer’s instructions. All qPCR was performed using a Biorad CFx96 thermal cycler.

Byerly J.H., Port E.R, & Irie H.Y. (2020). PRKCQ inhibition enhances chemosensitivity of triple-negative breast cancer by regulating Bim. Breast Cancer Research : BCR, 22, 72.

+ Open protocol

+ Expand

Embryonic and Postnatal Lingual Epithelial Analysis

Cited 3 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Lingual epithelium was collected from E11.5 embryos and P1 pups. Tongues were collected and bathed in (E11.5) or sub-epithelially injected (P1) with collagenase A (1 mg/mL Sigma Aldrich, 10103586001) and dispase II (2.5 mg/mL Sigma Aldrich, 04942078001) for 30 min at 37 °C, then tongue epithelium was separated from mesenchyme. RNA was extracted as previously described [15 (link)] and after normalization converted to cDNA using Thermo Fisher’s SuperScript™ First-Strand Synthesis System for RT-PCR.
RT-qPCR was carried out using Genecopoeia’s All-in-one qPCR mix with the following primers: K14 CAGCCCCTACTTCAAGACCA and GGCTCTCAATCTGCATCTCC [16 (link)]; K8 GGACATCGAGATCACCACCT and TGAAGCCAGGGCTAGTGAGT [17 (link)]; GAPDH ATGCCAGTGAGCTTCCCGTTCAG and CATCACTGCCACCCAGAAGACTG. PCR conditions were as follows: 95 °C for 15min, 40 cycles of 95 °C, 55 °C, and 72 °C for 30 s, 15 s, and 30 s respectively. Bands were visualized on a 3% agarose gel.
RNA-sequencing was carried out and analyzed as previously described [15 (link)]. Fragments Per Kilobase of transcript per Million mapped reads (FPKM) values were utilized to represent gene expression levels.

Kramer N., Chen G., Ishan M., Cui X, & Liu H.X. (2019). Early taste buds are from Shh+ epithelial cells of tongue primordium in distinction from mature taste bud cells which arise from surrounding tissue compartments. Biochemical and biophysical research communications, 515(1), 149-155.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!