Log In Sign up
The largest database of trusted experimental protocols

Super rt kit

Manufactured by BioTeke
Visit Supplier
Sourced in China

The BioTeke super RT kit is a laboratory equipment designed for reverse transcription, a crucial step in the analysis of RNA molecules. It provides the necessary components to convert RNA into complementary DNA (cDNA) for further downstream processing and analysis.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Thermo Fisher Scientific (4 mentions) Sybr premix ex taqtm, by Takara Bio (3 mentions) Allprep dna rna micro kit, by Qiagen (2 mentions) Quantitect whole transcriptome kit, by Qiagen (2 mentions) Faststart sybr green master, by Roche (2 mentions) Sybr green master mix, by Solarbio (2 mentions) Trizol, by Thermo Fisher Scientific (2 mentions) Mircute mirna qpcr detection kit, by Tiangen Biotech (1 mentions) Total rna isolation kit, by BioTeke (1 mentions) Gotag qpcr master mix, by Promega (1 mentions) Cfx96 real time system, by Bio-Rad (1 mentions) Mircute mirna first strand cdna synthesis kit, by Tiangen Biotech (1 mentions) Mirneasy mini kit, by Qiagen (1 mentions) Sybr green, by BioTeke (1 mentions) Power taq pcr mastermix, by BioTeke (1 mentions) Nano 2000 spectrophotometer, by Thermo Fisher Scientific (1 mentions) Sybr green, by Roche (1 mentions) Real time pcr, by Eppendorf (1 mentions) Plus sybr real time pcr mixture, by BioTeke (1 mentions) High purity total rna rapid extraction kit, by BioTeke (1 mentions)

14 protocols using super rt kit

1

Extraction and Detection of miR-340 and mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA extraction was carried out using Total RNA isolation kit (Bioteke Corporation, Beijing, China). For MicroRNA, we used miRcute miRNA first-strand cDNA synthesis kit and miRcute miRNA qPCR detection kit (SYBR Green) (Tiangen, Beijing, China) to detect the levels of miR-340 according to the manufacturer's protocol. U6 was as an internal control. Real-time PCR was performed on a CFX96 Real-Time System (Bio-Rad, USA) using the following primers:
MiR-340 stem loop primer: 5'-GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGACGTGGATACGACAATCAG-3'; forward primer, 5'-GCGGTTATAAAGCAATGAGA-3'; reverse primer, 5'-GTGCGTGTCGTGGAGTCG-3'; U6 forward primer, 5'-GCTTCGGCAGCACATATACTAAAAT-3'; reverse primer, 5'-CGCTTCACGAATTTGCGT. For mRNA, we put 2 μg of total RNA to reverse-transcribed with BioTeke super RT Kit (Bioteke Corporation, Beijing, China) to synthesize cDNA samples. 2 ml of cDNA product were used to polymerase chain reaction (PCR) amplification with Go Tag qPCR Master Mix (Promega, USA) on a thermal cycler using the following primers.
Shi Z., Li Y., Qian X., Hu Y., Liu J., Zhang S, & Zhang J. (2017). MiR-340 Inhibits Triple-Negative Breast Cancer Progression by Reversing EZH2 Mediated miRNAs Dysregulated Expressions. Journal of Cancer, 8(15), 3037-3048.
+ Open protocol
+ Expand
2

Breast and Mouse Cell RNA Extraction and qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
For breast cell lines, total RNA from cells was extracted with TRIzol reagent (Invitrogen, Waltham, MA) following the manufacturer’s instruction, and complementary DNA was synthesized using moloney murine leukemia virus (M-MLV) reverse transcriptase with random primers. cDNA was generated with BioTeke super RT kit (Bioteke, Beijing, China) according to the manufacture’s protocol. qRT-PCR was performed using SYBR Premix Ex TaqTM [TaKaRa (Beijing, China), RR820A]. The RT-PCR primer sequences are listed in Supplementary Data 3.
For mouse primary MECs, total RNAs from sorted YFP+ cells were purified by the Allprep DNA/RNA Micro kit (Qiagen, Germantown, MD), followed by amplification of RNA and generation of cDNA with QuantiTect Whole Transcriptome Kit (Cat. NO. 207043) according to manufacture’s protocol. qRT-PCR was performed using FastStart SYBR Green Master (Roche). The RT-PCR primer sequences are listed in Supplementary Data 3.
Hu X., Xiang D., Xie Y., Tao L., Zhang Y., Jin Y., Pinello L., Wan Y., Yuan G.C, & Li Z. (2019). LSD1 suppresses invasion, migration and metastasis of luminal breast cancer cells via activation of GATA3 and repression of TRIM37 expression. Oncogene, 38(44), 7017-7034.
+ Open protocol
+ Expand
3

Breast and Mouse Cell RNA Extraction and qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
For breast cell lines, total RNA from cells was extracted with TRIzol reagent (Invitrogen, Waltham, MA) following the manufacturer’s instruction, and complementary DNA was synthesized using moloney murine leukemia virus (M-MLV) reverse transcriptase with random primers. cDNA was generated with BioTeke super RT kit (Bioteke, Beijing, China) according to the manufacture’s protocol. qRT-PCR was performed using SYBR Premix Ex TaqTM [TaKaRa (Beijing, China), RR820A]. The RT-PCR primer sequences are listed in Supplementary Data 3.
For mouse primary MECs, total RNAs from sorted YFP+ cells were purified by the Allprep DNA/RNA Micro kit (Qiagen, Germantown, MD), followed by amplification of RNA and generation of cDNA with QuantiTect Whole Transcriptome Kit (Cat. NO. 207043) according to manufacture’s protocol. qRT-PCR was performed using FastStart SYBR Green Master (Roche). The RT-PCR primer sequences are listed in Supplementary Data 3.
Hu X., Xiang D., Xie Y., Tao L., Zhang Y., Jin Y., Pinello L., Wan Y., Yuan G.C, & Li Z. (2019). LSD1 suppresses invasion, migration and metastasis of luminal breast cancer cells via activation of GATA3 and repression of TRIM37 expression. Oncogene, 38(44), 7017-7034.
+ Open protocol
+ Expand
4

RT-qPCR Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
cDNA was generated from RNA using the BioTeke super RT kit (Bioteke, Beijing, China) according to the manufacturer’s protocol. qPCR was carried out using a SYBR GREEN mastermix (Solarbio, Beijing, China). PCR products were subjected to Sanger sequencing. Data were analyzed using the 2−ΔΔCt method and normalized to the expression levels of beta-actin (ACTB) or U6 small nuclear RNA. All primers are described in Additional file 1: Table S1.
Du R., Wu N., Bai Y., Tang L, & Li L. (2022). circMAP3K4 regulates insulin resistance in trophoblast cells during gestational diabetes mellitus by modulating the miR-6795-5p/PTPN1 axis. Journal of Translational Medicine, 20, 180.
+ Open protocol
+ Expand
5

RNA Extraction and Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA isolation and qRT-PCR assays were performed as described previously (37 (link)). Total RNA from cells was extracted with the miRNeasy Mini Kit (Qiagen), and complementary DNA was synthesized using moloney murine leukemia virus (M-MLV) reverse transcriptase with random primers. cDNA was generated with the BioTeke super RT kit (Bioteke) according to the manufacture’s protocol. qRT-PCR was performed using SYBR Premix Ex TaqTM (TaKaRa). The relative expressions of genes were calculated by normalization to the internal control Actin. Primers are listed in Supplementary Table 1.
Zhu X., Liu L., Wang Y., Cong J., Lin Z., Wang Y., Liu Q., Wang L., Yang B, & Li T. (2021). lncRNA MIAT/HMGB1 Axis Is Involved in Cisplatin Resistance via Regulating IL6-Mediated Activation of the JAK2/STAT3 Pathway in Nasopharyngeal Carcinoma. Frontiers in Oncology, 11, 651693.
+ Open protocol
+ Expand
6

Quantifying KDM2A mRNA Expression in ccRCC

Check if the same lab product or an alternative is used in the 5 most similar protocols
All the tissues were used to determine KDM2A mRNA level. Total mRNAs of ccRCC and paracancer tissues were extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA.) following the manufacturer’s protocols. Reverse-transcribed cDNA synthesis was performed with BioTeke Super RT kit (BioTeke, Beijing, China). Real-time PCR was conducted using 2 × Power Taq PCR MasterMix (BioTeke, Beijing, China) and SYBR Green (BioTeke, Beijing, China) according to the manufacturer’s instructions. β-actin acted as an internal control. The primers were synthesized as follows: KDM2A Forward 5′-GGCAGTAGGAATCAAGGACC-3′, Reverse 5′-ACCCGACAGCAGTGAGTAGA-3′; β-actin: Forward 5′-CACTGTGCCCATCTACGAGG-3′, Reverse 5′-TAATGTCACGCACGATTTCC-3′. PCR conditions were as follows: initial denaturation at 94 °C for 5 min, followed by 40 cycles of 94 °C for 15 s, 60 °C for 20 s, and 72 °C for 30 s. Each reaction was set up 3 times and the expression level of KDM2A was quantified using the 2−△△Ct method.
Wang J., Li T., Li X., Zhang Y, & Wang X. (2021). Expression pattern and regulatory effect of lysine-specific demethylase 2A gene in clear cell renal cell carcinoma. BMC Urology, 21, 108.
+ Open protocol
+ Expand
7

RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
We used TRIzol reagent (Invitrogen, Carlsbad, CA, USA) to extract total RNA from tissues or cells. RNA purity and concentration were determined using a NANO 2000 Spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) at 260 and 280 nm. cDNA was generated from RNA using the BioTeke super RT kit (Bioteke, Beijing, China) according to the manufacturer’s protocol. Subsequently, qPCR was carried out using a SYBR GREEN mastermix (Solarbio, Beijing, China). Data were analyzed using the 2-ΔΔCt method and normalized to the expression levels of β-Actin or U6. All primers are described in Table S1.
Du R., Bai Y, & Li L. (2022). Biological networks in gestational diabetes mellitus: insights into the mechanism of crosstalk between long non-coding RNA and N6-methyladenine modification. BMC Pregnancy and Childbirth, 22, 384.
+ Open protocol
+ Expand
8

Quantification of Apoptosis-Related Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated using Trizol reagent. cDNA was synthesized from total RNA (0.2-2 µg) using the Bioteke Super RT Kit (BioTeke Corporation, P. R. China). Real-time quantitative PCR (qPCR) was performed using DNA-binding dye SYBR Green (Roche, P. R. China). Amplification was performed using the following primers: β-actin forward primer 5'-CCAGCCGAGCCACATCGCTC-3', reverse primer 5'-ATGAGCCCCAGCCTTCTCCAT-3';
Bcl-2 forward primer 5'-CAGCTGCACCTGACGCCCTT-3', reverse primer 5'-CCCAGCCTCCGTTATCCTGGA-3'; Bax forward primer 5'-GATCAGCTCGGGCACTTTAG-3', reverse primer 5'-TTGCTGATGGCAACTTCAAC-3';
Caspase-3 forward primer 5'-CTGACTGGAAAGCCGAAACTC-3', reverse primer 5'-CGACCCGTCCTTTGAATTTCT-3'; GR forward primer 5'-GTGAAATGGGCAAAGGCCATAC-3', reverse primer 5'-GAAGAGAAACGAGCAAGCATAG-3'; MR forward primer 5'-GGCTACCACAGTCTCCCTGA-3', reverse primer 5'-AGAACGCTCCAAGGTCTGA-3'; and CRH forward primer 5'-CAGAACAACAGTGCGGGCTCA-3', reverse primer 5'-GGAAAAAGTTAGCCGCAGCCT-3'. Using the 2 -∆Ct method (Livak and Schmittgen, 2001) , relative expression levels of Bcl-2, Bax, Caspase-3, GR, MR, and CHR mRNA were calculated for each sample after normalization to the housekeeping gene β-actin.
Yang Q., Lin J.N., Sui X., Li H., Kan M., Wang J.F., Li J., Zhang Z., Liu X.R., Ming S.T., Qu X.B, & Li N. (2020). Antiapoptotic effects of velvet antler polypeptides on damaged neurons through the hypothalamic-pituitary-adrenal axis. Journal of integrative neuroscience, 19(3).
+ Open protocol
+ Expand
9

Quantifying Gene and RNA Expression in A549 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from A549 and A549/DDP cells using EZ-10 RNA Mini-Preps KitS (BIO BASIC INC, China). Total RNA was reverse transcribed to cDNA using Bioteke super RT Kit (Bioteke Corporation, China). The Real-Time PCR reactions were carried out in a 96-well microtiter plate using the power 2×SYBR Real-Time PCR Premixture kit (Bioteke Corporation, China) and Real-Time PCR (Eppendorf, USA). All samples were analyzed in triplicate in three independent experiments. The uorescence of the PCR products was detected by the same apparatus. The number of cycles for the ampli cation plot to reach the threshold limit (Ct value) was used for quanti cation. β-actin and U6 were used as endogenous controls. Using the Ct values obtained by the analysis software, the relative expression levels of EGR1 and MRP1 mRNAs, lncRNA HOTAIR, and miR-6807-3p were calculated through the 2 -ΔΔCt algorithm[26-28]. The primers used in PCR are shown in Table 4.
Shao S., Du Y., Zhu S., Zhang W., Zhang Z., Sun Y., Cui T., Liu X., Feng Y., & Liu C. (2020). Effect of EGR1-Mediated LncRNA HOTAIR on MRP1 Gene Expression and MDR in Lung Cancer.
+ Open protocol
+ Expand
10

RNA Extraction and cDNA Synthesis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA lysate was extracted from tissue samples or cell lines using Trizol (Invitrogen, Carlsbad, CA, USA) based on standard protocols, and cDNA synthesis was performed using a Super RT Kit (BioTeke, Beijing,China) following the manufacturer's protocol with the following primers:
UT‐B forward: 5′‐AATGTTCATGGCGCTCACCT‐3′, and reverse: 5′‐ACAAGCTGGCAATCCAACCT‐3′
GAPDH primers used for the human tissues:
Forward: 5′‐TGGTATCGTGGAAGGACTCATGAC‐3′
Reverse: 5′‐TGCCAGTGAGCTTCCCGTTCAGC‐3′
GAPDH primers used for the B16 cells:
Forward: 5′‐AGAAGGCTGGGGCTCATTTG‐3′
Reverse: 5′‐AGGGGCCATCCACAGTCTTC ‐3′
Liu L., Sun Y., Zhao Y., Wang Q., Guo H., Guo R., Liu Y., Fu S., Zhang L., Li Y, & Meng Y. (2018). Urea transport B gene induces melanoma B16 cell death via activation of p53 and mitochondrial apoptosis. Cancer Science, 109(12), 3762-3773.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!