Pcr2.1 topo cloning vector

E11 was amplified from MLO‐A5 cDNA‐ using primers designed to flank the E11 open reading frame (forward 5′‐AGCTCGTTTAGTGAACCGTCAG‐3′, reverse 5′‐CCACTTGTGTAGCGCCAAGT‐3′) and the following cycling conditions: 35 cycles of 92°C for 30 sec, 61°C for 60 sec and 72°C for 60 sec. The polymerase chain reaction (PCR) product was run on a 1% agarose gel, purified and ligated into the pCR2.1‐TOPO cloning vector (Invitrogen) according to the manufacturer's instructions. Individual clones of transformed XL1‐Blue E. coli (Stratagene, Santa Clara) were isolated from agar plates and the plasmid DNA sequenced to identify those containing the E11 insert (Genepool, University of Edinburgh). The insert was removed from the plasmid using EcoRI, ligated into the pLVX‐puro vector (Clontech, CA) and used to transform E. coli. Plasmids were screened by restriction digest with XhoI to identify clones which contained the insert in the correct orientation and plasmid DNA was amplified and extracted using the EndoFree Maxiprep kit (Qiagen, Sussex, UK). MLO‐A5 and ATDC5 cells were transfected with E11‐ and empty vector‐containing plasmids using Fugene HD transfection reagent (Roche; according to manufacturer's instructions). Transfections were performed in triplicate and transfected cells were positively selected in media supplemented with 2.5 µg/ml puromycin.

Genomic DNAs were isolated from MEF, fluorescence-activated cell sorting (FACS)-sorted iAs, and mouse pAs using a Genomic DNA Purification Kit (QIAGEN). Bisulfite conversion of genomic DNAs was carried out using the EZ DNA Methylation-Gold Kit (Zymo Research). The bisulfite-modified DNA was then used as a template for PCR to amplify the promoter region of Gfap. The amplified products were cloned into the pCR2.1-TOPO cloning vector (Invitrogen), and ten randomly selected clones were sequenced using T7 or M13R primers.

DNase-treated RNAs (∼1 µg per sample), isolated from leptospires grown to late-logarithmic phase at 30°C in vitro and within DMC, were prepared as described above and converted to cDNA using SuperScript III (Invitrogen) in the presence and absence of reverse transcriptase (RT) according to the manufacturer's instructions. cDNAs were assayed in quadruplicate using iQ Supermix (Bio-Rad) using the primer pairs described in Table S1. For relative quantitation of transcript levels, amplicons corresponding to each gene of interest were cloned into the pCR2.1-TOPO cloning vector (Invitrogen), then purified recombinant plasmid DNAs for each amplicon were diluted (10⁷–10² copies/µl) to generate a standard curve. Reaction conditions for each primer pair were optimized to ensure that each had an amplification efficiency of >90%. Transcript copy numbers for each gene of interest were calculated using the iCycler post-run analysis software based on internal standard curves then normalized against copies of lipL32 (LIC11352) present in the same cDNA. Normalized copy number values were compared within Prism v5.00 (GraphPad Software, San Diego, CA) using an unpaired t-test with two-tailed p values and a 95% confidence interval.

Female mice (8 weeks old, n=3 for each group) were used for oocyte sample collection for this assay. To quantify mtDNA copy number in MII oocytes, the Cox3 fragment was amplified and subcloned into the pCR™2.1-TOPO^® - cloning vector (Invitrogen, MA, USA) as previously described (35 (link)). The primer sequences used are listed in Supplementary Table S1. The One Shot TOP10 competent cells were used for plasmid transformation. After overnight incubation at 37 °C, the recombinant plasmids were extracted using the Qiagen plasmid isolation kit (Cat.12145, Qiagen, Hilden, Germany). The inserted mtDNA fragment was confirmed by DNA sequence analysis. The plasmid DNA was quantified using a NanoDrop 2000 spectrophotometer (Thermo Scientific, MA, USA). A standard curve from 10⁸ to 10¹ plasmid molecules was generated by serial 10-fold dilutions. Single MII oocyte was lysed in 10 μL of lysis solution before incubation at 55°C for 2 hours. The proteinase K in the lysis solution was denatured by heating at 95°C for 10 min and the mixture was used directly for downstream PCR in triplicates for each group. Each 10 μL reaction mixture contained 5 μL of Taq Pro Universal SYBR qPCR Master Mix (Cat. Q712-02, Vazyme, Nanjing, China), 0.3 μM primers, and oocyte DNA. The mtDNA copy number of each oocyte was then extrapolated from the standard curve.

Total bacteria and fungi in the midgut, pylorus/ileum, and rectum were quantified using the BactQuant and FungiQuant qPCR primers [55 (link), 56 (link)] on Bio-Rad CFX96 thermocyclers. To provide absolute quantification of 16S or 18S rDNA copy number and ensure inter-run comparability, in-run standard curves and no-template controls were included on each run. Plasmid standards for each assay were created using either a 16S or 18S gene clone (using Invitrogen pCR®2.1-TOPO™ cloning vector (#K4500-40) and DH5α™ cells (#18,265,017) per manufacturer’s specifications), purified via plasmid mini-prep kit (Thermo Scientific #K0503), dsDNA/µl was determined via Implen NanoPhotometer P300, and the known mass of plasmid plus PCR insert was used to calculate 16S or 18S plasmid standard copies per µl. Standard curves were calculated from a tenfold serial dilution of the plasmid standards included on each run.