Ab245467

PC9 and HCC827 cells were washed twice with ice-cold PBS and lysed with RIPA buffer (50 mM Tris, 1 mM EDTA, 150 mM NaCl, 1% Sodium deoxycholate, 0.1% SDS) (P0013B; Beyotime; China). The lysed samples were centrifuged for 15 min at a maximum speed (14000 rpm). The whole cell extracts were quantified by BCA Protein Assay kit (P0012S; Beyotime; China) and boiled for 5 min. Denatured proteins was separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred to PVDF membranes (Millipore). Subsequently, PVDF membranes were blocked with 5% milk-powder in PBST (1×PBS containing 0.1% Tween-20) for 1 ~ 2 h and then incubated overnight with primary antibodies, including CARM1 (Abcam; ab245467), CCNE2 (Abcam; ab32103), H3R17me2a (Abcam; ab8284), H3R26me2a (Abcam; ab194679), Histone H3 (Abcam; ab1791) and GAPDH (Abcam; ab181602). After washing with PBST, the PVDF membranes were incubated with horseradish peroxidase-conjugated secondary antibody (Sigma). Protein expression was visualized by enhanced chemiluminescence detection kit (Thermo Scientific Pierce). GAPDH was used as a loading control.

In brief, PC9 and HCC827 cells were collected and cross-linked with formaldehyde at room temperature for 10 min. Then, the chromatin is randomly sheared by sonication to generate chromatin fragments, generally ranging from 200 to 500 base-pairs. After sonication, 2 μg of CARM1 (Abcam; ab245467), H3R17me2a (Abcam; ab8284), H3R26me2a (Abcam; ab194679) or control rabbit IgG (Beyotime; A7016) were incubated overnight with chromatin fragments and protein G agarose. After washing with low salt, high salt, LiCl and TE buffers, the immune complexes were treated with elution buffer and eluted from the protein G agarose beads. DNA was extracted with phenol/chloroform and followed by ethanol precipitation. Purified DNA was dissolved in TE buffer or ddH₂O and analyzed by real-time PCR with specific primers for CCNE2 promoter. The primer sequences were as follows: (F) GAAAGACCTGGGTTCCCTGA, ® CTGCAACTCCTGGATTTCGG.

Surgically resected fresh NSCLC tissues were formalin-fixed, paraffin-embedded and sectioned. Briefly, the sections were treatment with hydrogen peroxide (H₂O₂) and then incubated overnight with the primary antibodies, and then with anti-mouse or anti-rabbit secondary antibody. Lastly, the sections were incubated with 3,3’-diaminobenzidine (DAB) substrate until the positive staining was achieved. The protein expression of CARM1 (Abcam; ab245467) or CCNE2 (Abcam; ab32103) in NSCLC tissues were evaluated blindly by two experienced pathologists. The protein expression was assessed according to staining intensity and percentage of positive cells to generate a histological score (H score). The H score was calculated using the formula: H score = ΣPi (i + 1), where i is the intensity score (0 ~ 3), and Pi is the percentage of stained positive cells (0% ~ 100%).