One shot stbl3 chemically competent escherichia coli

The catalytic, C-terminal domain of human DNMT3B (DNMT3B-C) (amino acids 553–853 of Q9UBC3) was cloned as His-tagged fusion protein into a pET28 expression vector. Mutagenesis was performed by inverse PCR amplifying the entire pET28(+) vector with Q5^® High-Fidelity DNA Polymerase (NEB) using primers with up to three mismatches at the 5′ end to introduce the desired mutation. The PCR products were loaded on a 0.5% agarose TPE gel and purified using NucleoSpin Gel and PCR Clean-up Mini kit (MACHEREY-NAGEL). The purified linearized vectors were then phosphorylated using T4 Polynucleotide Kinase (NEB) followed by circularization of the plasmids using T4 DNA Ligase (NEB). The ligated plasmids were then transformed into One Shot® Stbl3™ Chemically Competent Escherichia coli (ThermoFischer Scientific). After transformation, the cells were recovered in 1.5 ml centrifugation tubes in SOC medium at 37°C with horizontal shaking at 200 rpm for 1 h. Cell suspensions were then plated on 2% LB-agar containing kanamycin and incubated overnight at 37°C. Single colonies were used for inoculating liquid LB cultures containing kanamycin, which were grown overnight at 37°C with shaking at 200 rpm. The plasmid DNA was then isolated using the NucleoSpin Plasmid Mini kit for plasmid DNA (MACHEREY NAGEL) and sequences were confirmed by Sanger DNA sequencing.

The SpCas9 (pX551) and single-guide RNA (sgRNA, pX552) expression plasmids developed by the Zhang lab (Swiech et al., 2015 (link)) were obtained from Addgene. To generate Gba1 and Ppt1 sgRNA, 20-nt target sequences were chosen using the CRISPR design tool (https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design). sgRNA sequences were selected to precede a 5′-NGG protospacer-adjacent motif sequence and prioritized based on minimal off-target effects. The primers used to design the sgRNA targets are as follows: Gba1-1 (5′–3′) ACCCGTTACGAGAGCACTCGACG; Gba1-2 (5′–3′) ACCGGATAACTGGAAGTCGTTAG; Ppt1-1 (5′–3′) ACCTGTTAATGTCCAAGTCAACA; Ppt1-2 (5′–3′) ACCCCATGCCAGATCACCAGCGG. To generate sgRNA-expressing constructs, pX552 was digested using SapI Fast Digest (ThermoFisher Scientific, D1934) and annealed oligos were ligated using T7 DNA Ligase (NEB, M0318). Transformation was performed using One-Shot Stbl3 Chemically Competent Escherichia coli (Thermo, 737303). Following maxi prep (Qiagen, 12662), Sanger sequencing confirmed correct sgRNA insertion using the U6 promoter-sequencing primer (5′–3′) GAGGGCCTATTTCCCATGATTC.