Non targeting shrna control

PKCζ knockdown in human CB T-cells was carried out essentially as described recently for human macrophages [31 (link)]. Predesigned shRNA specific for PKCζ and non-targeting control shRNA were purchased from Sigma–Aldrich (Castle Hill, NSW, Australia). The human T-cell Nucleofection kit was from Amaxa (Lonza, Wakersville, MD, U.S.A.). Approximately 10⁶ cells were added to 4 μg of non-targeting control shRNA or PKCζ-specific shRNA in cuvettes and the cells were transfected using programme Y-010 according to the manufacturer’s instructions. After transfection, T-cells were cultured for 24 h before harvesting for maturation studies. An aliquot of the cultures was used to confirm the knockdown of PKCζ by Western blot analysis. Cell viability monitored by the Trypan Blue dye exclusion assay was >90%, being consistent with the information provided by the Nucleofection kit.

Antibodies used were as follows: SREBP1 (sc-13551, Santa Cruz Biotechnology, Dallas, TX, USA; 1:500 for WB), ACC (#3676, Cell Signaling Technology, Danvers, MA, USA; 1:1000 for WB), glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (MA5-15738, ThermoFisher Scientific, Waltham, MA, USA; 1:10,000 for WB), GS (G2781, Sigma-Aldrich, Burlington, MA, USA; 1:1000–1:10,000 for WB, and GTX630654, GeneTex, Irvine, CA, USA; 1:1000–1:10,000 for WB), Sp1 (07-645, Millipore, Burlington, MA, USA; 1:1000 for WB), O-linked N-acetylglucosamine (clone RL2) (MABS157, Millipore, Burlington, MA, USA; 1:500 for WB), horseradish peroxidase (HRP)-conjugated anti-mouse IgG (AP124P, Millipore, Burlington, MA, USA; 1:500 for SREBP1; 1:10,000 for GAPDH; 1:500–1:5000 for GS from GeneTex; 1:500 for O-linked N-acetylglucosamine), HRP-conjugated anti-rabbit IgG (AP132P, Millipore, Burlington, MA, USA; 1:1000 for ACC; 1:500–1:5000 for GS from Sigma-Aldrich; 1:500 for Sp1), and normal mouse IgG (#31903, ThermoFisher Scientific, Waltham, MA, USA). Insulin (Humulin R) was purchased from Eli Lilly and Company. L-Methionine sulfoximine (MSO) (M5379, Sigma-Aldrich, Burlington, MA, USA) was purchased from Sigma-Aldrich. Betulin (sc-234016, Santa Cruz Biotechnology, Dallas, TX, USA) was purchased from Santa Cruz Biotechnology. The shRNA targeting GS and non-targeting control shRNA were purchased from Sigma-Aldrich.

MISSION™ shRNA lentiviral transduction particles including a nontargeting shRNA control (Sigma) were used for generating Dab2 stable knockdown in C2C12 myoblasts (Supplementary Table 2). Lentiviral supernatant containing viruses was spin-infected (2250 rpm, 60 min at room temperature) using polybrene (8 μg/ml) to C2C12 cells (6000–8000 cells/well in 96-well plates) at multiplicity of infection (MOI) of 5. For stable cell line generation, the transfected C2C12 cells were subcultured and diluted to no more than one cell in each well of a 96-well plate. The cells were maintained in the growth medium containing 2 μg/μl puromycin for selecting positive infection. Cell colonies were formed in about 4–6 days after integration of lentiviral shRNA into the genome. The colonies were expanded, examined by real-time PCR for knockdown efficiency, and cryo-preserved in liquid nitrogen for further use.

hPSC-CM cells (1 × 10⁵ cells/well) were added in a 48-well plate. The pLKO.1-puro sh-RNA targeting YAP1 (5′-CCGGCCCAGTTAAATGTTCACCAATCTCGAGATTGGTGAACATTTAACTGGGTTTTTG-3′), LATS1 (5′-CCGGCAAGTCAGAAATCCACCCAAACTCGAGTTTGGGTGGATTTCTGACTTGTTTTT—3′) or pLKO.1-puro Non-Targeting shRNA Control (Sigma-Aldrich) lentiviral particles were added to the cells. At 72 hours post-transduction, SARS-CoV-2 (Isolate USA-WA1/2020) with a multiplicity of infection (MOI) of 0.01 was added. At 48 hours post-infection, cells were fixed in 4% paraformaldehyde for IHC studies or cell protein lysates were collected for western blot analysis.

hPSC-CM cells (1 × 10⁵ cells/well) were added in a 48-well plate. The pLKO.1-puro sh-RNA targeting YAP1 (5’-CCGGCCCAGTTAAATGTTCACCAATCTCGAGATTGGTGAACATTTAACTGGGTTTTTG-3’), LATS1 (5’-CCGGCAAGTCAGAAATCCACCCAAACTCGAGTTTGGGTGGATTTCTGACTTGTTTTT - 3’) or pLKO.1-puro Non-Targeting shRNA Control (Sigma-Aldrich) lentiviral particles were added to the cells. At 72 hours post-transduction, SARS-CoV-2 (Isolate USA-WA1/2020) with a multiplicity of infection (MOI) of 0.01, was added. At 48 hours post-infection, cells were fixed in 4% paraformaldehyde for IHC studies or cell protein lysates were collected for western blot analysis.