All qPCR assays were performed on the 7900HT Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA), and each 25 μl reaction comprised of the following: 5 μl 5 × HOT FIREPol® Probe qPCR Mix Plus (ROX) (Solis Biodyne, Tartu, Estonia), 1 μl (0.4 μM) forward primer, 1 μl (0.4 μM) reverse primer, 0.625 μl (0.25 μM) probe, 16.375 μl PCR-grade water, and 1 μl of DNA template. All reactions were performed in triplicate. The F. necrophorum (17 (link)) and D. nodosus (29 (link)) qPCR assays were performed using the cycling conditions previously described. Optimal qPCR cycling conditions for the three Treponema qPCR assays were empirically determined and comprised of a single activation step of 95°C for 12 min followed by 40 cycles of 95°C for 15 s and 61°C for 15 s and 72°C for 30 s. Analytical specificity and sensitivity were empirically defined for each assay. The baseline fluorescence signal was automatically calculated from the first 3–15 qPCR cycles. Where no increase in fluorescence signal was detected after 40 cycles, the bacterial load was classified as “undetectable,” i.e., below the limit of detection.
Hot firepol probe qpcr mix plus rox
Manufactured by Solis BioDyne
Sourced in Estonia
HOT FIREPol® Probe qPCR Mix Plus (ROX) is a ready-to-use master mix designed for probe-based real-time PCR (qPCR) applications. It contains all the necessary components, including a hot-start DNA polymerase, fluorescent probes, and ROX passive reference dye, optimized for sensitive and reliable quantification of target DNA sequences.
Automatically generated - may contain errors
Lab products found in correlation
7900ht fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Quantstudio 3 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Quantstudio design and analysis software v1, by Thermo Fisher Scientific (1 mentions)
Steponeplus system, by Thermo Fisher Scientific (1 mentions)
Nucleospin tissue kit, by Macherey-Nagel (1 mentions)
Topo ta plasmid, by Thermo Fisher Scientific (1 mentions)
Mgb nfq, by Thermo Fisher Scientific (1 mentions)
Sds v2, by Thermo Fisher Scientific (1 mentions)
Taqman snp genotyping assay, by Thermo Fisher Scientific (1 mentions)
Sensimix sybr hi rox mastermix, by Meridian Bioscience (1 mentions)
Cfx384 real time system, by Bio-Rad (1 mentions)
High capacity rna to cdna kit, by Thermo Fisher Scientific (1 mentions)
Taqman probe, by Thermo Fisher Scientific (1 mentions)
Taqman pre designed snp genotyping assay, by Thermo Fisher Scientific (1 mentions)
Qiaamp dna blood midi kit, by Qiagen (1 mentions)
Viia 7 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (1 mentions)
Omniscript reverse transcription kit, by Qiagen (1 mentions)
Random hexamer, by New England Biolabs (1 mentions)
Hot firepol evagreen qpcr supermix, by Solis BioDyne (1 mentions)
9 protocols using hot firepol probe qpcr mix plus rox
1
Multiplex qPCR Assays for Anaerobic Bacteria
2
Simultaneous Allelic Discrimination Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR was performed in 20 µl reactions containing 10 ng of DNA, 250 nM of each probe (5 pmol each) (for mutation 2: 500 nM for normal allele and 75 nM for mutated allele targeted probes, respectively), 500 nM of each primer (10 pmol each) and 1× HOTFIREPol PROBE qPCR Mix Plus (ROX) (Solis BioDyne, Estonia). The PCR program consisted of 30 s of initial reading at 60 °C, enzyme activation for 15 min at 95 °C, 40 cycles of 30 s at 95 °C and 1 min at 61 °C, and a final reading at 60 °C for 30 s. All PCR reactions were performed in a QuantStudio 3 real-time PCR system (Applied Biosystems, Thermo Fisher Scientific, USA). Results were analyzed in QuantStudio™ Design and Analysis Software v1.5.1 (Applied Biosystems, Thermo Fisher Scientific, USA) using allelic discrimination cartesian plot for genotype calls. Supplementary Figure S1 shows a representation of the allelic discrimination assays using real-time PCR with fluorescent probes. All mutations were analyzed simultaneously in a single assay under the described PCR program.
3
Quantitative PCR for HSV-1 DNA Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted using the NucleoSpin® Tissue Kit (Macherey-Nagel) according to manufacturer’s instructions. Media was diluted 200x before extraction and 100 µL used for extraction. DNA was eluted in 100 µL volume. For assessing the DNA copy number of HSV-1, a 118-nucleotide segment of the gB-1 region was amplified with primers described in85 (link). The qPCR reaction volume was set to 20 µL and contained 4 µL HOT FIREPol®Probe qPCR Mix Plus (ROX) (Solis Biodyne), primers and probe (forward primer at 0.5 µM, reverse primer at 0.5 µM and probe at 0.3 µM final concentrations), and 1 µl of DNA. Amplification of the target sequence was performed using the StepOne Plus system (Thermo Scientific). The reaction conditions were set to 10 min at 95 °C followed by 45 PCR cycles of two-step amplification (15 s at 95 °C and 60 s at 60 °C). HSV-1 Forward 5’-GCAGTTTACGTACAACCACATACAGC-3’; HSV-1 Reverse 5’-AGCTTGCGGGCCTCGTT-3’; HSV-1 Probe FAM-5’-CGGCCCAACATATCGTTGACATGGC-3’-MGBNFQ (Thermo Fisher Scientific). The efficiency of each round of PCR was determined using 10-fold dilutions of Topo TA plasmids (Invitrogen AB, Stockholm, Sweden) with insert of respective amplicon created according to the manufacturer’s instructions.
4
Genotyping Polymorphisms Using KASP Assays
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The polymorphisms have been identified with use of KASP™ genotyping assays provided by the LGC genomic laboratory (LGC, Hoddesdon, UK). In summary, KASP genotyping assays are based on competitive allele-specific multiplex PCR. Allelic discrimination is based on the competitive binding of two allele-specific primers labelled with FAM™ or HEX™ dye. The detailed described protocols can be found in the Biosearchtech producers user guide [33 ,34 ,35 ].
The SNPs that failed in the KASP multiplex assay were genotyped using TaqMan SNP Genotyping assays (Applied Biosystems, Foster City, CA, USA) and HOT FIREPol Probe qPCR Mix Plus (ROX) (Solis BioDyne, Tartu, Estonia) according to the manufacturer’s instructions. The amplification was done in AbiPrism 7900HT Real-Time PCR System. Data acquisition and analysis were performed using the allelic discrimination analysis module in SDS v2.4 software (Applied Biosystems, Singapore, Singapore). As a quality control measure, negative controls and ~5% of samples were genotyped in duplicate to check genotyping accuracy. Information about the analyzed SNPs, primers and assays is shown inTable S1 .
The SNPs that failed in the KASP multiplex assay were genotyped using TaqMan SNP Genotyping assays (Applied Biosystems, Foster City, CA, USA) and HOT FIREPol Probe qPCR Mix Plus (ROX) (Solis BioDyne, Tartu, Estonia) according to the manufacturer’s instructions. The amplification was done in AbiPrism 7900HT Real-Time PCR System. Data acquisition and analysis were performed using the allelic discrimination analysis module in SDS v2.4 software (Applied Biosystems, Singapore, Singapore). As a quality control measure, negative controls and ~5% of samples were genotyped in duplicate to check genotyping accuracy. Information about the analyzed SNPs, primers and assays is shown in
5
Analyzing RAS Gene Expression in Adipose and Muscle
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Here, we performed quantitative reverse transcription polymerase chain reaction (qRT‐PCR) analyses to determine the effects of ARB treatment on gene expression of RAS components in abdominal subcutaneous AT and skeletal muscle. Total RNA was extracted from the biopsies and stored at −80°C until analyses. Next, total RNA was reverse transcribed using the High‐Capacity RNA‐to‐cDNA Kit (Applied Biosystems, Foster City, California), and qRT‐PCR was performed in the CFX384 Real‐Time System (Biorad, Hercules, California). For both tissues, the geometric mean of ribosomal protein, large, P0 (RPLP0), ribosomal protein L26 (RPL26), and 18S RNA was used as internal control. Both SensiMix SYBR Hi‐ROX master mix (Bioline, London, UK) and HOTFIREPol Probe qPCR Mix Plus (ROX) (Solis Biodyne, Tartu, Estonia) were used for quantification of mRNA expression levels. TaqMan primers ACE (Hs001741179_m1), ACE2 (Hs01085333_m1), and AT1R (Hs00258938_m1) (Applied Biosystems) were used with HOTFIREPol Probe qPCR Mix Plus (ROX). Angiotensinogen (AGT), 18S, RPLP0, and RPL26 were amplified using SensiMix SYBR Hi‐ROX master mix and gene‐specific forward and reverse primers. Gene expression was defined using a derivative of the ΔΔCt method. The expression of the housekeeping genes was presented as 2 − ΔCt.
6
Dientamoeba-specific real-time PCR assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time PCR was performed using LightCycler LC 480 I (Roche, Basel, Switzerland) with a 96-well block under following conditions—95 °C/12 min; 50 × (95 °C/15 s; 60 °C/30 s; 72 °C/30 s) [61 (link)], using Master Mix (HOT FIREPol® Probe qPCR Mix Plus Rox, Solis BioDyne, Tartu, Estonia). Dientamoeba-specific primers and probe set for part of SSU rRNA gene consisted of forward primer Df-124F (5′–CAACGGATGTCTTGGCTCTTTA–3′) and reverse primer Df-221R (5′–TGCATTCAAAGATCGAACTTATCAC–3′), amplifying the ∼97 bp region and Taqman probe Df-172 (FAM-5′–CAATTCTAGCCGCTTAT-3′-MGB) (Generi Biotech, Hradec Králové, Czech Republic). All negative samples were tested for PCR inhibition by addition of foreign DNA (obtained from experimental rat tissues) and a specific qPCR protocol (commercial primers and Taqman probe for detection of the rat gene for beta-2 microglobulin; Thermofisher Scientific).
7
HCRTR1 rs2271933 Genotyping by RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from venous blood samples using Qiagen QIAamp® DNA Blood Midi Kit. The real-time polymerase chain reaction (RT-PCR) for genotyping the HCRTR1 rs2271933 polymorphism was performed using a TaqMan Pre-Designed SNP Genotyping Assay (Applied Biosystems; Foster City, CA, USA) C__15961465_10 containing primers and fluorescent probes. Genotyping reactions were performed in a total volume of 10 μl with ∼25 ng of template DNA. RT-PCR reaction components and final concentrations were as follows: 1:5 5 x HOT FIREPol® Probe qPCR Mix Plus (ROX) (Solis BioDyne) and 1:20
8
Hypoxia-Responsive Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time PCR was performed to investigate the relative mRNA expression of protein markers connected with hypoxia. Reverse transcription was performed using the Omniscript Reverse Transcription Kit (205113; Qiagen, Hilden, Germany) and random hexamers (New England Biolabs, Inc, Ipswich, MA, USA), and was carried out according to the manufacturer’s protocol. The mRNA level was quantified using 5 × HOT FIREPol Probe qPCR Mix Plus (ROX) (08-36-00001; Solis BioDyne, Tartu, Estonia) and by TaqMan Gene Expression Assays (4331182; Thermo Fisher Scientific), labeled with FAM reporter dye specific to human genes: ACTA2 (smooth muscle α-actin, Hs00909499_m1), FN1 (fibronectin 1, Hs01549976_m1), TGFB1 (transforming growth factor-beta 1, Hs0177257_m1), HIF1A (hypoxia-inducible factor, Hs00153153_m1) and MMP2 (matrix metalloproteinase-2, Hs001548724_m1). The experiments were performed with B2M as a reference gene (B2 microglobulin, Hs00187842_m1) using the Viia 7 Real-time PCR System (Applied Biosystems; Thermo Fisher Scientific) in a 96-well optical reaction plate.
9
Quantification of miRNA and mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were extracted from brain tissues (hippocampus) by using TRI Reagent® (TR 118) (Molecular Research Center, Inc., Cincinati, OH, USA). To measure mRNA expression, cDNA was synthesized using RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific) followed by qPCR using 5 × HOT FIREPol® EvaGreen® qPCR Supermix (Solis BioDyne, Tartu, Estonia) on a QuantStudio 12KFlex instrument (Thermo Fisher Scientific) according to the instructions of the respective manufacturers. Primer sequences for target genes were given in the Table S1 .
Quantification of miRNA expression was carried out using TaqMan® MicroRNA Assays hsa-miR-146a (Assay ID: 000468, Life technologies) and TaqMan® MicroRNA Assays hsa-miR-146b (Assay ID: 001097, Life technologies, Carlsbad, CA, USA) according to the manufacturer’s instructions. For cRNA synthesis, TaqMan® MicroRNA reverse transcription kit (4366596, Thermo Scientific) and for qPCR, 5× HOT FIREPol® Probe qPCR Mix Plus (ROX) (Solis BioDyne) were used, respectively. U6 snRNA (Assay ID: 001973, Life Technologies) was used for the normalization of RT-qPCR. To measure cell-specific expression of miR-146a and miR-146b, the respective cell populations were isolated as described above and then miRNA expression in each cellular population was measured using Taqman miRNA assay.
Quantification of miRNA expression was carried out using TaqMan® MicroRNA Assays hsa-miR-146a (Assay ID: 000468, Life technologies) and TaqMan® MicroRNA Assays hsa-miR-146b (Assay ID: 001097, Life technologies, Carlsbad, CA, USA) according to the manufacturer’s instructions. For cRNA synthesis, TaqMan® MicroRNA reverse transcription kit (4366596, Thermo Scientific) and for qPCR, 5× HOT FIREPol® Probe qPCR Mix Plus (ROX) (Solis BioDyne) were used, respectively. U6 snRNA (Assay ID: 001973, Life Technologies) was used for the normalization of RT-qPCR. To measure cell-specific expression of miR-146a and miR-146b, the respective cell populations were isolated as described above and then miRNA expression in each cellular population was measured using Taqman miRNA assay.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!