The largest database of trusted experimental protocols

Entranster r4000

Manufactured by Engreen Biosystem
Sourced in China

The EntransterTM-R4000 is a laboratory equipment designed for cell culture applications. It functions as a compact and efficient cell culture incubator, providing a controlled environment for the growth and maintenance of various cell lines.

Automatically generated - may contain errors

33 protocols using entranster r4000

1

Cell Culture and Transfection Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK293T, COS-7 and HeLa cell lines were purchased from China Center for Type Culture Collection (CCTCC). HEK293T and HeLa cells were cultured in Dulbecco's modified Eagle's medium (Gibco) supplemented with 10% fetal bovine serum (Gibco). COS-7 cells were cultured in RPMI Medium 1640 (Gibco) supplemented with 10% fetal bovine serum (Gibco). Lipofectamine® 2000 Reagent (Invitrogen) was used for COS-7 cell transfection according to the manufacturer's instruction with the modified dose of 1 μl per well on 24-well plate. Entranster™-R4000 (Engreen Biosystem) was used for HEK293T and Hela cell transfection according to the manufacturer's instruction with the modified dose of 0.5 μl per well on 24-well plate. The plasmid usage was listed in Table 1.
+ Open protocol
+ Expand
2

GLP-1R Silencing in Neural Progenitor Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
GLP-1R expression in NPCs was silenced by transfection of small interfering RNA (siRNA). NPCs were transfected with GLP-1R siRNA (GenePharma Biotechnology, Shanghai, China) using Entranster™-R4000 (Engreen Biosystem Co, Ltd.) according to the instructions. The siRNA silencing efficiency was determined 48 h post transfection by protein analysis for further experiments.
+ Open protocol
+ Expand
3

Modulating NSCLC Cell Migration and Invasion

Check if the same lab product or an alternative is used in the 5 most similar protocols
The NSCLC cell lines A549 and PC-9 were purchased from Conservation Genetics CAS Kunming Cell Bank and FuHeng Biology Company, respectively. Cells were cultured in RPMI-1640 medium supplemented with 10% FBS (both Gibco; Thermo Fisher Scientific, Inc.) and maintained in a humidified incubator containing 5% CO2 at 37°C. miR-30 family mimics or miR-30c or miR-30d inhibitors or XB130 siRNAs (Shanghai GenePharma Co., Ltd.) at a final concentration of 100 nM with or without DNA plasmids were transfected or co-transfected into cells using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) or Entranster™-R4000 (Engreen Biosystem Co., Ltd.) according to the manufacturer's instructions. Non-targeting sequences were used for miR mimics or inhibitors or siRNAs transfection controls. All sequences of the miRs and siRNAs used are presented in Table I. Cells used for western blotting and luciferase reporter assays were harvested 48 h after transfection. Wound healing and Matrigel invasion assays were performed 24 h after transfection.
+ Open protocol
+ Expand
4

Plasmid and miRNA Transfection Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Plasmids sh-OPN and sh-NC, as well as miR-34c and NCmimics were designed and synthesized by Wuhan Viraltherapy Technologies Co., Ltd. A549 and H460 cells were inoculated into Petri dishes one day in advance. On the second day, 1 μg of shRNA or miRNA mimics and 3 μL of Entranster-R4000 (EnGreen Biosystem, Beijing, China) were diluted into 50 μL with the serum-free medium. After standing for 10 min at indoor temperature, they were mixed into transfection complexes and added to cells that had been replaced with fresh medium. The transfection efficiency was assessed by Western blot. Subsequent experiments were performed 48 h after transfection.
+ Open protocol
+ Expand
5

Silencing ENST00000585297 in PBMCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
PBMCs were cultured in Roswell Park Memorial Institute (RPMI) 1640 medium (Gibco, Carlsbad, CA, USA) with 10% fetal bovine serum at 37°C with 5% CO2 for 24 h before transfection. ENST00000585297-siRNA and negative control (NC-siRNA) were designed and synthesized by GenePharma (Shanghai, China). Transient transfections were performed using Entranster™-R4000 (Engreen Biosystem, Beijing, China) to transfect the ENST00000585297-siRNA or NC-siRNA into PBMCs of pemphigus patients according to the manufacturer's instructions. The inhibition efficiency of specific siRNAs was detected by qRT-PCR. Cells were collected at 24 h after transfection for subsequent experiments.
+ Open protocol
+ Expand
6

Knockdown of BC168687 in SGCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
The following BC168687 siRNA and negative control siRNA sequences were synthesized (Novobio Scientific, Inc., Shanghai, China) and used: BC168687-rat-159 (5′-GAGAUUAUUAAGGUGUACUTT-3′), BC168687-rat-1172 (5′-GACGGUUGAUACUGACUCUTT-3′), BC168687-rat-2400 (5′-GUUGGAUCCUUCUCAAUCATT-3′) and negative control siRNA (5′-UUCUCCGAACGUGUCACGUTT-3′). The three different BC168687 siRNA duplexes were transfected into SGCs using the Entranster-R4000 (Engreen Biosystem, Ltd.) according to the manufacturer's protocol. After 48 h, the expression levels of BC168687 were evaluated by reverse transcription quantitative-polymerase chain reaction (RT-qPCR).
+ Open protocol
+ Expand
7

miR-223 Regulates FBXW7 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
A total of 1×106 HCT116 cells/well were transfected with miR-223 mimics or NC using Entranster™-R4000 (Engreen Biosystem, Ltd.), then transfected with 1 µg pTriEx-FBXW7 overexpression plasmid or empty plasmid 12 h later. The cells were collected 48 h later and lysed for protein detection by western blotting. The cell viability was also detected at the indicated times following miR-223 transfection and apoptosis rates were detected by flow cytometry at 48 h post-transfection.
+ Open protocol
+ Expand
8

Overexpression of miR-223 in HCT116 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The human HCT116 cell line was purchased from American Type Culture Collection and cultured in high-glucose DMEM (Thermo Fisher Scientific, Inc.) containing 10% FBS (Gibco; Thermo Fisher Scientific, Inc.) in a 37°C incubator with 5% CO2. Cells in the logarithmic growth phase (80% confluence) were used for experiments. The 50 ng pMIR-REPORT luciferase reporter plasmids (Ambion; 50 ng), miR-223 mimics (5′-UGUCAGUUUGUCAAAUACCCCA-3′), miR mimic control (miCtr, 5′-UUCUCCGAACGUGUCACGUTT-3′), miR-223 inhibitor (5′-UGGGGUAUUUGACAAACUGACA-3′) and miR-223 inhibitor control (Ctr; 5′-CAGUACUUUUGUGUAGUACAA-3′) were transfected using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.). Small interfering RNA (siRNA) targeting FBXW7 (siFBXW7−1, 5′-ACAGGACAGUGUUUACAAA-3′; siFBXW7−2, 5′-CCAUGCAAAGUCUCAGAAU-3′) and negative control (si-NC, 5′-UUCUCCGAACGUGUCACGUTT-3′) were transfected using Entranster™-R4000 (Engreen Biosystem, Ltd.), according to the manufacturer's instructions. All small nucleic acids were purchased from Shanghai GenePharma Co., Ltd. and were used at a final concentration of 20 nM. The cells were treated or collected at the indicated times after transfection.
+ Open protocol
+ Expand
9

Transfection Silencing and Overexpression of LINC00174

Check if the same lab product or an alternative is used in the 5 most similar protocols
Transfection experiments to silence LINC00174 were performed using Caco-2 cells with relatively high LINC00174 expression. Transfection experiments to overexpress LINC00174 were performed using COLO201 cells. Moreover, Caco-2 cells were used to cotransfect LINC00174 and the miR-2467-3p mimic. siLINC00174, siENO3, LINC00174, miR-2467-3p mimic, and corresponding siNC/NC/mimic NC were obtained from GenePharma Co., Ltd. (China). Briefly, 50 pmol (0.67 μg) plasmid was diluted with 25 μL of serum-free DMEM (reagent A). Then, 1 μL of Entranster™-R4000 (Engreen) and 24 μL of serum-free DMEM were mixed for 25 min (reagent B). The transfection complex was prepared by thoroughly mixing 25 μL of reagent A and 25 μL of reagent B (aspirate 10 times using a pipette) and standing for 15 min. Cells in 0.45 mL of complete medium were transfected with 50 μL of the transfection complex. siNC/NC/mimic NC plasmids were used as controls.
+ Open protocol
+ Expand
10

miR-20a and Map3k9 Silencing in T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
For miR-20a and Map3k9 silencing, a chemically modified ssRNA oligonucleotide, miR-20a antagomir, was applied to knock down the expression of miR-20a, and small interfering RNA (siRNA) duplexes of Map3k9 were used for the knockdown of Map3k9. The antagomirs, siRNAs, and negative control were synthesized by GenePharma Ltd. (Shanghai, China), and their sequences were as follows. miR-20a antagomir: 5’-CUACCUGCACUAUAAGCACUUUA-3’; Map3k9 siRNA: sense, 5’-GGACCAGCUAACGACUAUATT -3’, antisense, 5’- UAUAGUCGUUAGCUGGUCCTT -3’; NC antagomir: 5’- CAGUACUUUUGUGUAGUACAA -3’. The CD4+ T cells isolated from splenocytes and lymph node cells were transfected with the miR-20a antagomirs (200 nM), Map3k9 siRNA (400 nM), or negative control using Entranster™-R4000 (Cat. 4000-3, Engreen, Beijing, China) and harvested 12 h after transfection for the following experiments.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!