RNA from double mutant cases II.1, 16, 33, 42 and 66 was isolated using the RecoverAll™ Total Nucleic Acid Isolation Kit for FFPE (Ambion). Reverse transcription was carried out with Superscript III (Invitrogen) followed by amplification of exons 14 and 15 of FGFR1 (primers and conditions are available upon request). Ligation into a TOPO blunt vector (Invitrogen) was performed according manufacturer recommendations and posterior transformation of OneShot TOP10 E.coli competent cells. Bacterial culture was performed overnight in LB agar with kanamycin. A minimum of 25 colonies were cultured overnight; DNA was purified with QIAamp DNA Mini Kit and followed by Sanger sequencing.
Topo blunt vector
Manufactured by Thermo Fisher Scientific
Sourced in United States
The TOPO blunt vector is a cloning vector used for the direct ligation of blunt-ended PCR products. It provides a simple and efficient method for the direct insertion of blunt-end DNA fragments into a plasmid. The vector contains a lacZ gene for blue-white screening and antibiotic resistance genes for selection.
Automatically generated - may contain errors
Lab products found in correlation
Proteinase k, by Thermo Fisher Scientific (2 mentions)
Recoverall total nucleic acid isolation kit for ffpe, by Thermo Fisher Scientific (1 mentions)
Superscript 3, by Thermo Fisher Scientific (1 mentions)
Qiaquick pcr purification kit, by Qiagen (1 mentions)
Dneasy kit, by Qiagen (1 mentions)
E coli jm109, by Takara Bio (1 mentions)
Pgem t easy vector, by Promega (1 mentions)
7 protocols using topo blunt vector
1
FGFR1 Exon Sequencing in Mutants
2
Mutational Analysis of the fbp1 Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The genome sequence around UAS1, UAS2 and TATA box in the fbp1 promoter region was amplified using primers p5 and p6 (Supplemental Table S2 ) and cloned into TOPO Blunt vector (Invitrogen). A ura4+ selection cassette was inserted at the HpaI site between UAS1 and UAS2. The resultant plasmid was digested with NdeI, and transformed to gain ura4 inserted strain at fbp1 promoter region. Site-directed mutagenesis of UAS1 and UAS2 were performed using primers p7 and p8 and primers P9 and P10, respectively, using the method previously described (33 (link)) (Supplemental Table S2 ). The underlined bases in the sequence presented in Supplementary Table S2 indicate mutated sites. These mutations diminish fbp1 transcription as well as TF-binding activity (27 (link)). In the case of the TATA box mutation, the TATA sequence of fbp1 mRNA (34 (link)) is converted to a BamHI site as described above using primers p11 and p12 (Supplementary Table S2 ). The mutated plasmid was digested with NdeI and transformed into the ura4-inserted strain, and cells carrying the mutated UAS1, UAS2 or TATA box were selected by 5-FOA. Introduction of mutations was confirmed by sequencing.
3
Analysis of Switch Junction Regions in Splenic B Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After LPS stimulation for 4 days, splenic B cells were collected for genomic DNA isolation using the DNeasy kit (Qiagen). Sμ–Sγ3 regions were amplified using nested PCR with details and primers as previously described (41 (link)). PCR products were purified with QIAquick PCR purification kit (Qiagen), ligated to Topo Blunt vector (Invitrogen) and transformed in E. coli chemical competent cells. Plasmids from individual E. coli colonies were purified and sequenced for the inserted switch junctional regions. Switch junctions were analyzed by alignment using BLAST2seq with the automatic low-complexity filter disabled and using consensus sequences from the NC_000078.6 GenBank record. The nonparametric Kruskal-Wallis test followed by the Dunn's post-tests were used to calculate P-values and interrogate whether the different groups showed identical distributions of microhomology lengths at the Sμ–Sγ3 junctions (computed as 0 for blunt junctions, as positive values for short and long microhomologies, and as negative values for insertions). Frequency of insertions was calculated by dividing the number of ocurrences by the total number of Sμ–Sγ3 junctions characterized in each group, and statistically compared through Fisher's exact tests.
4
Generating Lrit3 Knockout Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
C3H/HeNTac/C57BL/6NTac hybrid embryos (363) were injected with 10 ng/μl Lrit3 ZFN mRNA and 254 viable embryos were implanted into nine Swiss Webster recipient mothers. Tail biopsies from offspring were collected and genomic DNA isolated using Direct Tail PCR solution (Thermo Scientific) supplemented with 0.2 μg/ml proteinase K (Thermo Scientific). Primers (5′- TAACCTGGGCATAGCCTGTC -3′; 5′-AAGGTCCAGGAAGGAGAAGG -3′) were used to amplify the ZFN targeted region (chr3:129503565, mm9). PCR fragments were either sequenced directly or cloned into the TopoBlunt vector (Invitrogen) and at least 10 clones sequenced. The Lrit3-/- allele was backcrossed onto C57Bl/6J mice for 10 generations.
5
Generation of RNF12 Stable Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell lines stably expressing 2xFLAG-V5-RNF12 and 2xFLAG–V5-RNF12H569A,C572A were generated by electroporation of Rlim+/− (also termed Rnf12+/−) female mESCs F1 2-1 (129/Sv-Cast/Ei) (Jonkers et al, 2009 (link)), with pCAG-2xFLAG–V5-Rnf12 or pCAG-2xFLAG–V5-Rnf12H569A,C572A vectors followed by puromycin selection. The coding sequence of Rnf12 was amplified from mESC cDNA and cloned into a TOPO blunt vector (Invitrogen). Rnf12H569A,C572A mutant was generated by PCR-site-directed mutagenesis. For mammalian expression, the WT and mutant Rnf12 coding sequences were subcloned into the pCAG-2xFLAG-V5 vector.
6
Generation of Recombinant Influenza H7N3 and H7N9 Viruses
7
Cloning and Expression of Mannanase Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Strain N. jabiensis ID06-379 was provided from Biotechnology Culture Collection (BTCC), Indonesian Institute of Sciences (LIPI), and used throughout this work. N. jabiensis ID06-379 was grown in an actinomycetes medium named International Streptomyces Project 2 (ISP2) at 28 • C for 3-5 days. Escherichia coli Nova Blue (Invitrogen, Carlsbad, CA, USA) and TOPO Blunt vector (Invitrogen, Carlsbad, CA, USA) was used as the host and vector, respectively, to construct a partial mannanase gene of strain N. jabiensis ID06-379. For the maintenance and propagation of plasmids, we used pGEM ® -T Easy vector (Promega, Madison, WI, USA), E. coli Nova Blue (Invitrogen, Carlsbad, CA, USA), and E. coli JM109 (Takara, Shiga, Japan). For cloning and expression of a mannanase gene, an expression system was used that involved pUC702 (E. coli-Streptomyces shuttle vector containing S. cinnamoneus phospholipase D promoter) [29] and S. lividans 1326. E. coli was grown in Luria Bertani (LB) medium at 37 • C for 18-24 h, and S. lividans 1326 recombinant was grown in Trypticase Soy Broth (TSB) medium supplemented with 1% (w/v) tryptone, 3% (w/v) glucose and 5 µg/mL of thiostrepton at 28 • C for 72 h with shaking at 180 rpm.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!