Quantstudiotm

RNA quantification of the different genes was achieved by a two-step real-time reverse transcription qPCR (RT-qPCR). Primer sequences (fwd,rev) were from Sigma Life Sciences, Switzerland: POMC (5′AACGCCATCAAGAAC3′ and 5′AAGGTTTTATTTCCTAACTACAC3′); NR3C1 (5′CAGAGAATGTCTCTACCCTG3′ and 5′CTTAGGAACTGAGGAGAGAAG3′); MC2R (5′AGAAACTGGATCCTTCCG3′ and 5′TGGTGTGTTCATACGAATTG3′); β-actin (5′CTAAGGCCAACCGTGAAAAGA3′ and 5′ACAACACAGCCTGGATGGCAT3′); IL-6 (5′TGCCCTTCAGGAACA3′ and 5′AAGGCAGTGGCTGTC3′); ADRB2 (5′AAAGAGAGAGAGAGAGACT3′ and 5′ACAACACTTCAGACAGAAAC3′); HPRT (5′ACTGGTAAAACAATGCAGGAC3′ and 5′CCTGAAGTGCTCATTATAGTC3′); PtPrc (5′GCTATAAAAAGACCCCTTCAG3′ and 5′CATAGGCAAATAGAGACACTG3′); ARRB2 (5′GCAGCCAGGACCAGAGGACA3′ and 5′CCACGCTTCTCTCGGTTGTC3′). PCR was run on Quantstudio 5 (Thermofisher Scientific; Norway) and analyzed using Quantstudio^TM Design and Analysis Software.

RT-PCR assay for SARS-CoV-2 (QuantStudioTM, Thermo Fisher Scientific, Waltham, MA, USA) using nasopharyngeal swabs (NPS) in 3 mL viral transport medium (VTM) was assessed [16 (link),17 ]. RNA from all samples was extracted using MagMAX Viral/Pathogen II (MVP II) Nucleic Acid Isolation Kit (Thermo Fisher Scientific, Waltham, MA, USA) following the instructions recommended by the manufacturer. To calculate the viral loads (VL) as SARS-CoV-2 genome copy numbers per mL, a standard curve was obtained by using a quantified supernatant from a cell culture isolate of SARS-CoV-2. The target genes of the RT-PCR were Orf-1ab, N Protein and S Protein. Samples with a cycle threshold (Ct) value from 10 to 35 were considered positive, higher values were considered negative. Samples with Ct equal to or greater than 35 were repeated at least twice being the viral load rather low.