Dephosphocoa

RNAs containing different cap structures were synthesized by in vitro transcription of synthetic double stranded DNA template ϕ2.5-AG-30 containing the T7 ϕ2.5 promoter with an adenosine at the transcription start site (CAGTAATACGACTCACTATTAGCCCTCTCTTCCTTCCTTCCTCCTTTCCT). In vitro transcription was carried out at 37°C overnight, using HiScribe^TM T7 High yield RNA Synthesis kit (New England Biolabs).
To generate 5′ end ³²P-labeled NAD-capped RNA, ribose ATP was omitted from the reaction and replaced with ³²P-NAD (PerkinElmer) to initiate transcription. The resulting RNA contains a single ³²P label within the alpha phosphate of the NAD (Npp*A). Similarly, to generate FAD- or dephosphoCoA-capped RNAs containing a ³²P-Guanosine at the +2 position, FAD (Sigma) and dephosphoCoA (Sigma) were the only adenosine containing molecules in the mixture to initiate transcription. The reaction was carried out in the presence of [α-³²P]GTP to incorporate a single ³²P-label at the +2 position within the capped RNA.

CoA pull-down was performed in the presence of purified WT NME1 or the T94D mutant. Three micrograms of WT or mutant GST-tagged or untagged NME1 was incubated overnight at 4°C (300 μl final volume) with 50 μl of pre-washed CoA-agarose resin (buffer: 20% glycerol, 3 mM MgCl₂, 50 mM Hepes, 500 mM KCl, 1 mM DTT, and one mini-tablet of EDTA-free protease inhibitor) in the presence or absence of ATP (Sigma-Aldrich). The enriched CoA-agarose was washed three times in the buffer and, after a final wash with PBS, was incubated for 1 hour at 4°C in 50 μl of 5 mM free ligand (either CoA, NAD, FAD, ADP-ribose, ATP, or dephospho-CoA; all from Sigma-Aldrich) or 50 μl of H₂O as a control. Flow-through and CoA-agarose (eluted by free CoA) fractions were analyzed by WB to detect NME1 (by an anti-GST or anti-NME2 antibody) as well as histidine phosphorylation. GST-NME1 and GST-NME2 were also pulled down using extracts from bacteria expressing these proteins, following the same protocol as the CoA pull-down from eukaryotic cell extracts.

DMEM (Cat#11965) was purchased from ThermoFisher (Waltham, MA, USA). Oasis HLB SPE columns were purchased from Waters (Milford, MA, USA). 5-sulfosalicylic acid, etomoxir, pantothenate, dephospho-CoA, and acyl CoA standards were purchased from Sigma-Aldrich (St. Louis, MO, USA). (E)-but-2-enoyl Coenzyme A (crotonoyl CoA) was purchased from Avanti Polar Lipids (Alabaster, Alabama, USA).