C met overexpression plasmid

The doxycycline-inducible sh-cMet cell line and MET overexpression cell lines were generated as previously described [7 (link)]. Briefly, the doxycycline-inducible shMet plasmid was generated by cloning sh-c-Met sequence (annealed two oligonucleotides; 5′-CCGGCAGAATGTCATTCTACATGAGCTCGAGCTCATGTAGAATGACATTCTGTTTTT-3′, and 5′-AATTAAAAACAGAATGTCATTCTACATGAGCTCGAGCTCATGTAGAATC ACATTCTG-3′) into Tet-PLKO-Puro vector (Addgene). The c-Met overexpression plasmid was purchased from Origene. Recombinant LCN2 and G-CSF were purchased from R&D system (#1857-LC and #214-CS). LCN2 antibody was purchased from R&D system (#AF1857). doxycycline was purchased from Sigma Co, Burlington, NJ, USA.

Lentivirus plasmids containing pLKO.1-shc-Met (TRCN0000040043, TRCN0000040044), pLKO.1-shEGFR (TRCN0000039633, TRCN0000039636) and pLKO.1-shIGF1Rβ (TRCN0000000422, TRCN0000000426) were purchased from GE Dharmacon. The c-Met overexpression plasmid (RC217003) was purchased from OriGene Technologies, Inc. (Rockville, MD, USA). The pLKO.1-shGFP (Addgene plasmid #30323), the lentiviral packaging plasmid psPAX2 (Addgene plasmid #12260) and the envelope plasmid pMD2.G (Addgene plasmid #12259) were available on Addgene (Cambridge, MA). The generation of gene stable knocking down cell lines was performed as described previously [51 (link)]. Briefly, pLKO.1-sh-GFP or pLKO.1-shRNA lentivirus plasmids were co-transfected into 293T cells with psPAX2 and pMD2-G. Viral supernatant fractions were collected at 48 hours after transfection and filtered through a 0.45 μm filter followed by infection into cells together with 10 μg/mL polybrene. At 16 hours after infection, the medium was replaced with fresh medium containing 1 μg/ml puromycin and cells were incubated for another 6 days.