Easyscript reverse transcriptase

Total RNA was extracted from colon cancer cells using TRIzol (Invitrogen, Carlsbad, CA, USA). EasyScript® Reverse Transcriptase (TransGen Biotech Co., Beijing, China) was used to reverse RNA into cDNA. The level of DDR gene (ATR, XLF, XRCC1, RPA1, BRCA2, and RAD51) was quantified using the SYBR Green PCR mix (Bioresearcher, Beijing, China) through CFX96TM Real-Time System (Bio-Rad). The reaction mixture underwent 38 cycles consisting of denaturation for 10 s at 95°C and annealing and prolongation for 30 s each at 60°C. GAPDH was used as the endogenous controls. All assays were replicated three times. The primers used for PCR are shown in Supplementary 3.

Total RNAs were extracted by using TRI reagent (Molecular Research Center, Inc.). RNAs were reverse transcribed by using EasyScript Reverse Transcriptase (Transgen Biotech). Then, cDNA was amplified by PCR or qPCR with the primers listed in Supplementary Table 3. qPCR was performed with SYBR TOPreal qPCR 2× preMIX (Enzynomics) to determine transcript abundance. Transcript quantity was calculated by using the ∆∆C_t method, and Hprt or HPRT1 levels were used as housekeeping controls.

RT-qPCR was performed according to the method described by Liu et al. [21 (link)], with β-Actin as the reference gene, the genes on the MPs and citrinin gene cluster were selected, and the expression of these genes was detected by qRT-PCR during the submerged fermentation of M. purpureus LQ-6 and M. purpureus CSU-M183, respectively. For removal of residual genomic DNA, RNA samples were treated with RNase-free DNaseI (Thermo Fisher Scientific, Massachusetts, USA) following the manufacturer’s protocol. The first-strand cDNA was synthesized using oligo-dT primers and EasyScript Reverse Transcriptase (TransGen Biotech, Beijing, China), according to the manufacturer’s protocol. qRT-PCR was performed using the TransStartGreen qPCR SuperMix UDG (TransGen Biotech, Beijing, China) according to the manufacturer’s instructions. 2^−ΔΔCT was used to determine expression levels of the tested genes. The primers used in these analyses were listed in S1 Table.

The total RNA was extracted from the LNCaP and LNCaP-AKR1C3 cells with the RNAeasy™ Animal RNA Isolation Kit with Spin Column (Beyotime Biotechnology, Shanghai, China).
RNAs were reverse-transcribed into cDNAs using EasyScript Reverse Transcriptase (Transgen Biotech, Beijing, China). qRT-PCR was performed using FastStart Universal SYBR Green 2X Master Mix (Roche, Basel, Switzerland), and the primer sequences are listed in Table S4 in the Supplementary Materials.

Cells were lysed by RNAiso (Takara, Otsu, Shiga, Japan). The total RNA was extracted and then reverse-transcribed into complementary DNA using Easyscript Reverse Transcriptase (TransGen Biotech, Beijing, China). Quantitative real-time PCR was conducted using TOPreal qPCR 2X PreMIX (Enzynomics, Daejeon, Republic of Korea) with a CFX Connect Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). The mRNA expression level was normalized by Actb. Primers with the following sequences were used: Hk1 (sense, CGGAATGGGGAGCCTTTGG; antisense, GCCTTCCTTATCCGTTTCAAT), Hk2 (sense, GGGCATGAAGGGCGTGTCCC; antisense, TCTTCACCCTCGCAGCCGGA), Hk3 (sense, CTGAGTCAAGGCTGTATCCTCC; antisense, TGCACCAGTTCAGCATCTGAGG), G6pc3 (sense, AGCAGGTAGCCGCTTCATTT; antisense, AGCCGGTTCTGTAGTGCTTC), Glut1 (sense, TCAACACGGCCTTCACTG; antisense, CACGATGCTCAGATAGGACATC), Glut3 (sense, TTCTGGTCGGAATGCTCTTC; antisense, AATGTCCTCGAAAGTCCTGC), Phgdh (sense, CCTCCTTTGGTGTTCAGCAGCT; antisense, CGCACACCTTTCTTGCACTGAG), Actb (sense, ACCCACACTGTGCCCATCTAC; antisense, GCCATCTCCTGCTCGAAGTC).

Total RNA was isolated from explant-derived cultures from HME patients and controls using Trizol standard procedures. To synthesize cDNA, 5 µg total RNA was reverse transcribed using the random primers (TaKara Biotechnology, Dalian, China) and EasyScript ReverseTranscriptase (TransGen Biotech, Beijing, China). The cDNA products were used directly as templates for PCR amplification. The primers used for the EXT2 human cDNA were: forward: 5′-GGGAGTATAATGAACTGCTCA-3′; reverse: 5′-GCTCCACGAAGAACCACA-3′. The expected sizes of the EXT2 mRNA and cDNA were 3651 and 589 bp respectively. The PCR products were resolved by 1.5% agarose gel electrophoresis and visualized by ethidium bromide staining (Sigma-Aldrich, Beijing, China). The nucleotide sequences were determined by direct sequencing of the PCR products (ABI 3100 DNA sequencer, Applied Biosystems).
The repeated PCR products were cloned into the PMD-18-T vector (TaKaRa Biotechnology, Dalian, China) and amplified in the E. coli TOP10 reference strain. Clones were picked up through blue-white spot screening on AMP/IPTG/X-Gal L-agar plates. After plasmid extraction, sequencing of the clones was conducted to evaluate the percentage of alternative transcripts that was present.