Revertra plus kit

Total RNA was prepared from samples using extraction reagent (Sepasol‐RNA I Super G; Nacalai Tesque, Kyoto, Japan), and cDNA was synthesized by reverse transcription using the ReverTra Plus kit (Toyobo, Osaka, Japan). The expression levels of target genes were analyzed using a 7500 Fast Real‐Time PCR machine (Applied Biosystems, Foster City, CA, USA) with Thunderbird SYBR qPCR Mix (Toyobo). Experiments were carried out in triplicate and data were calculated using the ΔCt method. The sequences of the primers used for quantitative RT‐PCR are shown in Table 1.

Total RNA was isolated from the cells using TRIzol Reagent (Invitrogen) according to the manufacturer's instructions, and 1 mg total RNA was reverse transcribed using the ReverTra-Plus™ kit (Toyobo, Osaka, Japan). The primer sequences used for amplification were as follows: SIRT1 forward, 5′-AAAGGAATTGGTTCATTTATCAGAG-3′ and reverse, 5′-TTGTGGTTTTTCTTCCACACA-3′; PGC-1α forward, 5′-AAACTTGCTAGCGGTCCTCA-3′ and reverse, 5′-TGGCTGGTGCCAGTAAGAG-3′; and β-actin forward, 5′-TGAACGGGAAGCTCACTGG-3′ and reverse, 5′-GCTTCACCACCTTCTTGATGTC-3′. Comple mentary DNA samples were amplified using SYBR Premix Ex Taq (Tli RNaseH Plus; Takara, Otsu, Japan) and detected with the Roche LightCycler 480 real-time PCR system. β-actin was used as an internal control for SIRT1 and PGC-1α normalization.
For the analysis of miR-29b expression, enriched small RNAs were isolated from the cochlear tissues using TRIzol Reagent, with 500 ng of RNA being reverse transcribed using specific miRNA stem-loop primers and a PrimeScript RT reagent kit (Takara). Mature miRNA expression was measured with Takara Taq version 2.0 plus dye (Takara) according to the manufacturer's instructions, and the miRNA levels were normalized to U6 small nuclear RNA expression.

Total RNA was extracted from right atrial tissues (20 specimens from SR and 32 specimens from AF) using TRIzol reagent (Tiangen). The cDNA was generated from 1 μg of total RNA using the ReverTra-Plus kit (TOYOBO) and real-time PCR was carried out using the SYBR^® green Real-time PCR Master Mix (TOYOBO) following the manufacturer’s instructions. The relative gene expression levels of the KCNN1, KCNN2, and KCNN3 were normalized to the housekeeping gene (β-actin). The mRNA expression levels were calculated by the 2^−ΔΔCt method. The primer sequences used were as follows:

We detected HAC1 mRNA according to the method in a previous report [24 (link)]. Briefly, cultured cells were disrupted by using the Multi-Beads Shocker (Yasui Kikai) with 0.5-mm glass beads, and total RNA was extracted by means of the NucleoSpin RNA Plus kit (Takara Bio) according to the manufacturer's instructions. cDNA was synthesized from total RNA via the ReverTra-Plus Kit (Toyobo); it was then used as the template for individual PCR with primers (HAC1 Fw and HAC1 Rv). The PCR products were run on 2 % agarose gels. Tunicamycin-treated cells (1 μg/mL, for 1 h) were used as a positive control.

Total RNA was extracted from fibroblasts using the RNeasy Mini Kit (Qiagen, Hilden, Germany). Complementary DNA was generated using oligo-d(T) primers and the ReverTra-Plus kit (Toyobo, Osaka, Japan). Quantitative real-time expression analysis was performed using THUNDERBIRD SYBR qPCR Mix (Toyobo) on the StepOnePlus Real-Time PCR system (Thermo Fisher Scientific). We used the standard curve quantification method with GAPDH as the reference gene. Primers are as follows: GAPDH-Fw, GAAGGTGAAGGTCGGAGTCAACG; GAPDH-Rv, GAAGATGGTGATGGGATTTCC; HSD17B4-Fw, AGTTGCTTTTGATAGGTGCAG; and HSD17B4-Rv, AAAGCTCATTCCACATAGGTTTG.